ID: 1073799524

View in Genome Browser
Species Human (GRCh38)
Location 10:107026085-107026107
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799518_1073799524 -4 Left 1073799518 10:107026066-107026088 CCCCACACACATCAAAAGGAAAT 0: 1
1: 0
2: 4
3: 56
4: 496
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799520_1073799524 -6 Left 1073799520 10:107026068-107026090 CCACACACATCAAAAGGAAATCA 0: 1
1: 0
2: 1
3: 32
4: 367
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799516_1073799524 -2 Left 1073799516 10:107026064-107026086 CCCCCCACACACATCAAAAGGAA 0: 1
1: 0
2: 5
3: 41
4: 379
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799519_1073799524 -5 Left 1073799519 10:107026067-107026089 CCCACACACATCAAAAGGAAATC 0: 1
1: 0
2: 3
3: 30
4: 293
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799513_1073799524 23 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799517_1073799524 -3 Left 1073799517 10:107026065-107026087 CCCCCACACACATCAAAAGGAAA 0: 1
1: 0
2: 7
3: 50
4: 516
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799514_1073799524 20 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr