ID: 1073803894

View in Genome Browser
Species Human (GRCh38)
Location 10:107074199-107074221
Sequence GCCCGGTGTTGGGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073803894_1073803902 22 Left 1073803894 10:107074199-107074221 CCTGCACTCCCCCAACACCGGGC 0: 1
1: 0
2: 0
3: 42
4: 316
Right 1073803902 10:107074244-107074266 TCCATAGTTTGGTCTTTTCCAGG No data
1073803894_1073803901 11 Left 1073803894 10:107074199-107074221 CCTGCACTCCCCCAACACCGGGC 0: 1
1: 0
2: 0
3: 42
4: 316
Right 1073803901 10:107074233-107074255 TTTTTACTGTCTCCATAGTTTGG 0: 6
1: 16
2: 26
3: 52
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073803894 Original CRISPR GCCCGGTGTTGGGGGAGTGC AGG (reversed) Intronic
900002936 1:24932-24954 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900022657 1:195457-195479 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900227470 1:1539981-1540003 GGCCGGGGTGGGGGGAGCGCAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903340928 1:22653784-22653806 GCAAGGTGTTGGGGAAATGCTGG - Intronic
904114335 1:28150538-28150560 GCACTGTGTTGGTGGAGTCCAGG + Exonic
905445714 1:38027384-38027406 GCAGGGTGTTGGGGAAGGGCGGG + Intergenic
905796502 1:40819153-40819175 GGTCGGGGTAGGGGGAGTGCTGG + Intronic
905875206 1:41427802-41427824 GCCAGGGGGTGGGGGAGTCCAGG + Intergenic
906101472 1:43266507-43266529 ACCAGGTGTTGTGGGGGTGCTGG - Intronic
907274803 1:53311186-53311208 ACTCGGTGTTGGGGGTGGGCAGG - Intronic
909003610 1:70249136-70249158 GCAGGGTTTTGGGGGACTGCAGG + Intronic
909797463 1:79759616-79759638 GCCAGGTGGTGGGGGAGTGGGGG - Intergenic
910349376 1:86277959-86277981 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
910546571 1:88425404-88425426 GCCTGGAGTTGTGGGAGTGATGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912625556 1:111202910-111202932 GCCTGGTGTTGGGGCAGGGGTGG + Intronic
914716209 1:150257183-150257205 GCCTGGGGTGGGGGGAGTGCGGG - Exonic
914937575 1:151993946-151993968 GCCCGGGGTCGGGGGAGTCGGGG - Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
919640146 1:200038959-200038981 GCCAGGGGTTGGGGGAAGGCTGG - Intronic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
919739083 1:200971839-200971861 GCCCAGTGTTGGGGGGAGGCAGG - Intronic
919937813 1:202266191-202266213 GCCTGGAGGTGGGGGAGTGGGGG + Intronic
920555988 1:206904989-206905011 GCCTGGGGTTGGGGGATAGCTGG + Exonic
922196502 1:223364239-223364261 GGCGGGTGTTGGGGGAGGACGGG + Intergenic
922762810 1:228142937-228142959 GCCCTGTGCTGGGCGAGTGTAGG + Intronic
924553505 1:245099482-245099504 GCCTGGTGTCGGGGCAGGGCGGG - Intronic
1063422265 10:5922742-5922764 GCCTGGTGCTGTGTGAGTGCCGG + Intronic
1065136290 10:22673603-22673625 GCCTGGTGTTGAGGGGCTGCAGG - Intronic
1065426957 10:25615859-25615881 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1068243301 10:54334130-54334152 GCCAGGTGTTTGGGGCGTGTGGG - Intronic
1069076274 10:64041641-64041663 GCCTGGGGTTGGGGGAGGGATGG + Intergenic
1071509920 10:86255007-86255029 GCCTGGTCTTGGGGGTGTGGAGG - Intronic
1071966518 10:90857826-90857848 GCCGGGGGTCCGGGGAGTGCGGG - Intergenic
1072053022 10:91725159-91725181 GCCAGGTGCTGGCAGAGTGCTGG - Intergenic
1072344442 10:94489376-94489398 GCCAGGGGTTGGGGGAGGGGTGG + Intronic
1073137026 10:101225796-101225818 GCCCTGTTTTCGGGGAGTGCAGG + Intergenic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1073959861 10:108912873-108912895 GCAGGGTGTGGGGGGAGTGCTGG + Intergenic
1074172174 10:110952515-110952537 GCTAGGGGTTGGGGGAGTGAGGG - Intronic
1075048768 10:119166330-119166352 GCCCTGTGCTGGGGAAGGGCAGG - Intergenic
1075072081 10:119326247-119326269 GCCTGGTGTGGGTGGGGTGCAGG + Intronic
1075721883 10:124592322-124592344 GCCCGGGGCTGGGTGAGTGAGGG - Intronic
1076337840 10:129720441-129720463 GCCCGGTGCTGTGGGAGGGTTGG - Intronic
1076376759 10:129993505-129993527 GCCTGGGGTTGGGGGAGGGGTGG - Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077079769 11:720047-720069 GCCAGGTGCTGGGGGTGGGCAGG - Exonic
1077607909 11:3624777-3624799 GCCAGGTGAAGGGGCAGTGCAGG - Intergenic
1077858802 11:6157155-6157177 GCCTGGGGTTGGGGGAGGGGTGG - Intergenic
1079081267 11:17415178-17415200 CCCCAGTGTTGGGGGAGGCCAGG - Intronic
1079473954 11:20808469-20808491 GCCTGGGGTTGGGGGAGGGCTGG + Intronic
1080006128 11:27408977-27408999 AACAGGTGTTGGGGGAGAGCAGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083571534 11:63764294-63764316 GCCTGGTGTGCGGGGTGTGCGGG - Exonic
1083614950 11:64021644-64021666 GCCAGGAGTTGGGGGGGTGGGGG + Intronic
1083753611 11:64777786-64777808 GCGCGCTGTGGGGGGAGGGCTGG - Intronic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1085336532 11:75701006-75701028 GCCCTGTGATGTTGGAGTGCTGG + Intergenic
1085345874 11:75768069-75768091 GCCCTGGGCTGGGGGAGTGGGGG - Intronic
1085391875 11:76186273-76186295 GCCTGGTGTGGGGGGAGCGCGGG + Intergenic
1085400771 11:76234244-76234266 GCCCGGGGGTGGGGCAGAGCAGG + Intergenic
1087417204 11:97872022-97872044 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1089309362 11:117547626-117547648 GCGGGGTGTTGGGGGAGGGAAGG - Intronic
1089328291 11:117672394-117672416 GCCATGTGTTTGGGGAGTGGGGG - Intronic
1091314625 11:134604788-134604810 GCCAGGGGTTGGGGGAGAGTGGG - Intergenic
1091376355 12:26995-27017 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1091820619 12:3472883-3472905 GCCAGGTCTTGGGGAAGCGCTGG + Intronic
1092238952 12:6825963-6825985 GACGGCTCTTGGGGGAGTGCAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095953722 12:47795235-47795257 GCCCGGCGGTGGGGGAGCGGTGG + Exonic
1096178974 12:49540228-49540250 GCCCGGAGTGGGGAGAGCGCAGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097899337 12:64857546-64857568 GCCTGGGGTTGGGGGAGGGATGG + Intronic
1099610153 12:84857681-84857703 GCCTGGGGTTGGGGGAGTGGTGG + Intergenic
1101640405 12:106582650-106582672 GCCCGATGGTGGGGAAGGGCCGG + Intronic
1102305822 12:111803924-111803946 GCCGGGAGTTGGGCGAGTACGGG + Exonic
1102819094 12:115892915-115892937 GCCAGGGGCTGGGGGAGTGGGGG - Intergenic
1103528018 12:121580350-121580372 GCCCGGGCTTGGGGGGGTGGGGG + Intronic
1104891757 12:132143713-132143735 GCCTGGTGCTGGGGGGGTTCGGG - Exonic
1105502925 13:20988483-20988505 TCACGGTGTTGGGGGCGGGCAGG + Exonic
1107524271 13:41214377-41214399 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1107557177 13:41527039-41527061 GGTCAGTGTTGGGGGAGTGATGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108494428 13:51009982-51010004 GCCATGGGTTGGGGTAGTGCAGG - Intergenic
1111639238 13:90946974-90946996 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
1112133303 13:96548090-96548112 GCACGGTGTGGGGGGCGTGCAGG - Intronic
1112505351 13:99971467-99971489 GCCCGGAGTTGGGAGTGGGCGGG + Exonic
1113475492 13:110577809-110577831 GCCAGGGGTTGGGGGAGGGAAGG - Intergenic
1115282456 14:31678743-31678765 GCCTGGGGTTGGGGGAGTGTTGG + Intronic
1116340228 14:43713869-43713891 GCCTGGTGTTGGGGCAGGCCTGG - Intergenic
1118096784 14:62546313-62546335 GCCAGGGGTTGGGGGAGGGGTGG - Intergenic
1118951025 14:70436868-70436890 GCTCGGGGTTGGGGGGGTGTTGG + Intergenic
1119224932 14:72937785-72937807 GAAGGATGTTGGGGGAGTGCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120987083 14:90343763-90343785 GGGCGGTGTGGGGGGAGTGGGGG + Intergenic
1122132700 14:99614330-99614352 GCCTGGTGTTGGGGCTGAGCTGG - Intergenic
1122919737 14:104875075-104875097 GCCCTGTGGTGGGGCAGTGATGG + Intronic
1123752901 15:23372558-23372580 TCCCGGTGTTTTGGGATTGCAGG - Intergenic
1124125199 15:26932937-26932959 GGCCTGTGGTGGGGTAGTGCGGG + Intronic
1124406397 15:29396263-29396285 GCCCGGGGCTGGGGGAGAGAGGG - Intronic
1124952646 15:34337868-34337890 GCCCGGGGCTGGGGGAGGCCAGG - Intronic
1125606063 15:40940668-40940690 GCCTGGTGTTGTGGACGTGCAGG - Intergenic
1125760111 15:42090566-42090588 GCCCTGTGGTGGGGTAATGCAGG + Intronic
1125760479 15:42092940-42092962 GCCCTGTGGTGGGGCAATGCAGG + Intronic
1126773452 15:52079524-52079546 CCAAGGTGTTGGGGGAGGGCAGG - Intergenic
1127173419 15:56328028-56328050 GCCTGGGGTTGGGGGAGGGGTGG - Intronic
1129030692 15:72615658-72615680 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1129150411 15:73684605-73684627 GCCCGGACCTGGGGGAGGGCAGG - Intronic
1129321731 15:74778799-74778821 GGCCAGTGTTGGAGGAGTGGGGG - Intergenic
1129477533 15:75796181-75796203 GCCTGGGGTTGGGGGAGCGGTGG + Intergenic
1129741800 15:77992882-77992904 GCCTGGAGTGGGGGGAGTGGGGG - Intronic
1129852821 15:78804309-78804331 GCCGGGGGTTGGGGGAGCTCTGG + Intronic
1130511735 15:84595176-84595198 GCCTGGGGTTGGGGGAGGGGTGG - Intergenic
1132304621 15:100802331-100802353 GCTCGGTGTTGGGTGTCTGCTGG + Intergenic
1132450573 15:101966007-101966029 GCCCTGTGGTGGGTGGGTGCAGG + Intergenic
1132620621 16:866494-866516 GCCAGGGGTTGGGGGAGTCCAGG + Intronic
1132879051 16:2153240-2153262 GCCCTGGGCTGGGGGAGTCCTGG - Intronic
1132937896 16:2490871-2490893 GTCAGGGGTTGGGGGACTGCAGG + Intronic
1133081678 16:3326273-3326295 GCCTGGTGTAGGGTGAGTGCTGG - Intergenic
1134541447 16:15070048-15070070 GGTCAGTGTTGTGGGAGTGCTGG - Exonic
1135359439 16:21799628-21799650 GGTCAGTGTTGTGGGAGTGCTGG - Intergenic
1135436906 16:22434605-22434627 GGTCAGTGTTGTGGGAGTGCTGG - Intronic
1136263356 16:29097316-29097338 GGTCAGTGTTGTGGGAGTGCTGG + Intergenic
1136574016 16:31112574-31112596 GCCCCGTGTGTGGGGAGGGCAGG + Intronic
1137256273 16:46778002-46778024 GCGGGGTGTGGGGGGAGCGCAGG + Intronic
1137426487 16:48385116-48385138 GCCCGGTAATGGCGGAGGGCGGG - Intronic
1137526663 16:49242247-49242269 GCCCTGAGTTGGGGAAGTGCTGG - Intergenic
1140379070 16:74470226-74470248 GCCTGTTGTAGGGGGAGTACTGG - Intronic
1141839533 16:86565938-86565960 TCCCGGTCTTCTGGGAGTGCGGG + Intergenic
1142193043 16:88726636-88726658 GCCAGGAGCTGGGGGAGAGCAGG + Exonic
1142400578 16:89856204-89856226 GCCCGGTGCGGGGCGAGGGCTGG + Exonic
1203074032 16_KI270728v1_random:1108180-1108202 GCCGGGTGCTGCAGGAGTGCGGG - Intergenic
1143094026 17:4467154-4467176 TCACGGTGATGGGGGAGTGAGGG + Intronic
1144457071 17:15427690-15427712 GCATGGTGGTGGGGGAGTCCTGG - Intergenic
1144731291 17:17527963-17527985 GCCAGGTGGTGGGGGGGTCCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146003416 17:29145616-29145638 GCCCAGTGCTAGGTGAGTGCTGG - Intronic
1147459846 17:40561224-40561246 GAGGGGAGTTGGGGGAGTGCTGG + Intronic
1147465524 17:40607815-40607837 GCGGGGGGTTGGGGGAGGGCAGG + Intergenic
1148446845 17:47743090-47743112 CTCCTGTGTTGGGGGAGTCCGGG - Exonic
1148754035 17:49963201-49963223 GCCTGGTGTGGGGGGAGGGTAGG - Intergenic
1148829608 17:50422764-50422786 GCCAGGGGTTGGGGGTGTGGTGG - Intergenic
1149772593 17:59332605-59332627 CTCCGGTCTTGGGGGCGTGCGGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152694791 17:81738706-81738728 GCCCAGTGTCGAGGGAGGGCCGG - Intergenic
1152753479 17:82077361-82077383 GCCTAGTGTTGGGGGACCGCAGG + Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153503873 18:5775085-5775107 GCCAGGTGCTGGGGCAGTGAGGG - Intergenic
1155282012 18:24249949-24249971 GCCTGGGGTTGGGGGAGGGATGG - Intronic
1155767383 18:29652702-29652724 GCCTGGAGTTGGGGGAGAGGTGG - Intergenic
1156036514 18:32771762-32771784 GGCAGGTGTTGGGGGAGGGGTGG + Intronic
1156475519 18:37403159-37403181 GGCTGGGGTTGGGGGAGGGCGGG + Intronic
1159362418 18:67422758-67422780 GCCAGAGGTTGGGGGAGGGCGGG - Intergenic
1160508636 18:79441183-79441205 ACCCGGAGATTGGGGAGTGCAGG + Intronic
1160634687 19:66540-66562 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1161220001 19:3114068-3114090 TCCCGGTGCTGGGGGAGGGCCGG - Intronic
1161275663 19:3415479-3415501 GCATGGGGTTGGGGGAGTGGAGG - Intronic
1161495839 19:4585072-4585094 CCCCGGGGCTGGGGGAGTGCTGG + Intergenic
1161794928 19:6381089-6381111 GCCCGGTGGCGGGGGAGGCCTGG - Intronic
1162904867 19:13817571-13817593 TCACGGGGTTGGGGGAGCGCGGG - Intronic
1163006719 19:14401581-14401603 GCCCAGGGTTGGGGCAGGGCAGG - Intronic
1163110785 19:15160041-15160063 GCCAGGGGTCGGGGGAGTGTTGG - Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163440445 19:17320086-17320108 GACCGGTGTTGGGGGGGAGAAGG - Exonic
1164270734 19:23669475-23669497 GCACGGTGGTGGGGGGGTGGGGG + Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164713540 19:30375666-30375688 GCCTGGAGATGGGCGAGTGCAGG + Intronic
1165095223 19:33406543-33406565 GCAAGGTGGTGGGGGAGAGCTGG + Intronic
1165120226 19:33554014-33554036 GCCCGGTGTTGGTGTGGTGCTGG - Intergenic
1165402944 19:35613342-35613364 GGCGGGTGGTGGGGGAGCGCGGG - Intronic
1165632670 19:37315040-37315062 GCCCGGGGTTAGGGGAGTTGGGG - Intronic
1165913936 19:39246774-39246796 ACCTGGTGTTGGGGGTGTCCTGG + Intergenic
1165916930 19:39266154-39266176 ACCTGGTGTTGGGGGTGTCCTGG - Intergenic
1165951023 19:39474031-39474053 GCCAGGTGTTTGGGGATTGGGGG - Exonic
1166529322 19:43533377-43533399 GTCCGGCGTCGGGGGAGGGCAGG - Exonic
1166678965 19:44756211-44756233 GCCTGGGGGTGGGGGAGTGAAGG - Exonic
1167110310 19:47456900-47456922 CCCCGGGGTGGGGGGTGTGCAGG - Intronic
1167787963 19:51651329-51651351 ACCAGGTGTAGGGGAAGTGCAGG + Intergenic
926054832 2:9768460-9768482 GCCAGGTGTTGGGGCAGGGAGGG - Intergenic
926616021 2:14997421-14997443 GCCTGGCGTTGGGTCAGTGCTGG - Intergenic
929934704 2:46286313-46286335 GCCCAGTGGAGGGGTAGTGCTGG + Intergenic
932003669 2:67907025-67907047 GCCCTGGGTGGGGGGAGTGGAGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
932858851 2:75267342-75267364 GCCTGGGGTTTGGGGAGTGGTGG + Intergenic
933576923 2:84079896-84079918 GCCTGGGGTTGGGAGAGTGGTGG + Intergenic
934619308 2:95794238-95794260 GGCCGGGCTTGGGGAAGTGCTGG + Intergenic
934641584 2:96030319-96030341 GGCCGGGCTTGGGGAAGTGCTGG - Intronic
934692456 2:96372193-96372215 GCCTGGGGTTGGGGAAGAGCTGG + Intronic
934863013 2:97780130-97780152 GACCTGTGTTGGGGAATTGCTGG + Intronic
935405868 2:102708281-102708303 GTGGGGTGTTGGGGGGGTGCTGG - Exonic
936566790 2:113588487-113588509 GCCCTGTGGTGGGGGCGTGCCGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938962159 2:136353619-136353641 GCCAGGTGTGGGGGGGGGGCGGG + Intergenic
939629729 2:144517081-144517103 GGGGGGTGTTGGGGAAGTGCCGG - Intronic
940605369 2:155916999-155917021 GTACGGTGGTGGTGGAGTGCTGG + Intergenic
941096666 2:161245098-161245120 GCCCGGGGTCGGGGGAGGCCGGG + Intergenic
941534942 2:166710828-166710850 GCATGGTGTTGGGGGAGAGGAGG - Intergenic
943099595 2:183471872-183471894 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
944096631 2:195975605-195975627 GCCTGGGGTTGGGGGAGGGATGG - Intronic
947229728 2:227872686-227872708 GCCGGGGGTTGGGGGGGTGGGGG - Intronic
947332442 2:229044391-229044413 GCCAGGTGGTGGTGGAGTGCAGG - Intronic
947788857 2:232850431-232850453 GCTGAGTGTTGGAGGAGTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1171199339 20:23228450-23228472 ACATGGTGTTGGGGGAGTGAGGG - Intergenic
1171481851 20:25460480-25460502 GCCAGGTGCTGAGGAAGTGCTGG + Intronic
1172793616 20:37522719-37522741 GGCAGGTGTTGGGGGAGCGCAGG + Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174379266 20:50146298-50146320 GCCTCGTGTGGGGGGAGTGTGGG - Intronic
1175110832 20:56646786-56646808 GCCCTGAGGTGGGGGTGTGCTGG + Intergenic
1175514351 20:59559507-59559529 GCCTGCTGTGGGAGGAGTGCAGG + Intergenic
1176008015 20:62876683-62876705 GCCTGGTGTGGGGAGGGTGCTGG + Intergenic
1176054585 20:63137335-63137357 GCCAGGGGTTGGGGGTGTGGTGG - Intergenic
1176276126 20:64270401-64270423 GCACGGTGTGGGGTGAGTGTGGG + Intronic
1176335991 21:5600717-5600739 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176391766 21:6220231-6220253 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176469653 21:7095943-7095965 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176493214 21:7477721-7477743 TCCCGATGTTGGGGGAGCGTTGG - Intergenic
1176507428 21:7660662-7660684 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1179566367 21:42251615-42251637 GCCTGGTGTGGGGGAAGTGGAGG + Intronic
1180080610 21:45486054-45486076 GCCCGGTGTGGGGGGCGTGAGGG - Intronic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1181055683 22:20259587-20259609 GCTCTGGGTTGGGGGAGGGCAGG - Intronic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1182725363 22:32441078-32441100 GCAGGGGGTTGGGGGAGAGCAGG - Intronic
1183208172 22:36433469-36433491 GCCCAGTGGAGGTGGAGTGCAGG - Intergenic
1183933677 22:41249879-41249901 GCGCGGTGTTGGGGGAACCCTGG - Intronic
1184250578 22:43257997-43258019 GCCTGGTCTTGGGGGGCTGCAGG + Intronic
1184367900 22:44064076-44064098 GGCTGGTGTTGGGGTGGTGCTGG + Intronic
1185123970 22:48993695-48993717 GCCTGGTGTTGGTGTGGTGCGGG - Intergenic
1185167325 22:49269699-49269721 GCCTGATGTTGGGGGGGAGCGGG - Intergenic
951091641 3:18580231-18580253 GCCTGGTGTCGGGGTAGTGGAGG - Intergenic
951259971 3:20495872-20495894 GCCTGGGGTTGGGGGAGAGATGG + Intergenic
951279617 3:20732008-20732030 GCCAGGTGCTGGGGGAGGGGTGG + Intergenic
952566784 3:34668760-34668782 GCCTGGTGTTGGAGGAGGGGTGG - Intergenic
953637930 3:44678266-44678288 GGTGGGTGTTGGGGGAGTCCAGG - Intergenic
954160275 3:48716865-48716887 TCCCGGGTTTGGGGGAGGGCAGG - Intronic
954416819 3:50397354-50397376 GCCCGGTGGTGGGGGAGGAAGGG + Intronic
955056465 3:55459976-55459998 GCCCTTTGTTGGGTGGGTGCTGG + Intergenic
955760165 3:62271534-62271556 GCCCTGTGTTGGTGCACTGCAGG + Exonic
957637195 3:82801688-82801710 GGCCAGTGTTGGGCGAGTGAAGG - Intergenic
958839910 3:99191436-99191458 GCCTGGTGTTGGGGGAGGGGTGG - Intergenic
959358837 3:105366180-105366202 GCCGGGTGTGAGGGGAGTGGTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
963001769 3:140688191-140688213 GCACGGGGTAGGGGGAGGGCAGG - Exonic
963179366 3:142338163-142338185 GCCTGGGGTTGGGGGAGTTGGGG - Intronic
963602999 3:147393376-147393398 GCCGGGTGTTGGCGGGGGGCGGG - Intronic
964253636 3:154749792-154749814 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
965322333 3:167265538-167265560 GCCTGGGGTTGGGGGAGGGATGG + Intronic
965350037 3:167600198-167600220 GCCTGGGGTTGGGGGAGTCGTGG + Intronic
966114256 3:176443174-176443196 GGCAGGGGATGGGGGAGTGCAGG - Intergenic
966868521 3:184275953-184275975 GCCCGGGGTGGGGGGAGGGTGGG - Intronic
967247304 3:187501078-187501100 GGCTGGAGTTGGGGGATTGCTGG + Intergenic
968596711 4:1489675-1489697 GCCAGGTGCTGGGGGATTCCTGG + Intergenic
968961988 4:3750390-3750412 ACACGGTGCTGGGGGAGTGGGGG - Intergenic
969056747 4:4407203-4407225 GGTCGGGGTTGGGGGAGTGGAGG + Intronic
974300975 4:60067047-60067069 GCCTGGGGTTGGGGGAGGGGTGG - Intergenic
976171781 4:82311660-82311682 GCCTGGGGTTGGGGGAGAGTTGG + Intergenic
985200115 4:187476045-187476067 GCCTGCTGGTGTGGGAGTGCTGG + Intergenic
985399329 4:189578733-189578755 GGCCGGTTTTGGGGGTGTGTGGG + Intergenic
985990920 5:3560585-3560607 GCCCAGTGTTGTGGGAGTGGAGG - Intergenic
986746610 5:10750371-10750393 GCCAGCTGCTGGGGCAGTGCTGG - Intronic
989638076 5:43557076-43557098 GCCGGGTTTTGGGGGAGAACTGG - Exonic
990579110 5:57151157-57151179 GCCCGGGGTTGGGGGAGGGGTGG + Intergenic
991395368 5:66198967-66198989 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
992527568 5:77628029-77628051 CCCCGGGGTTGGGGGAGCCCTGG + Intergenic
993981198 5:94545399-94545421 GCCTGGGGTTGGGGGAGGGGTGG - Intronic
995708989 5:115015667-115015689 GCCAGGGGTTGGGGGAGGGAAGG + Intergenic
996459472 5:123725073-123725095 GCCAGGTGTTGTGGGAGGGATGG - Intergenic
997013613 5:129905453-129905475 GGCCGGCGTTGGGGGGCTGCTGG - Exonic
997694163 5:135848367-135848389 GCCAGGTGGTGGAGGGGTGCAGG - Intronic
998133565 5:139663117-139663139 GCCAGGGGTTGGGGGAGGGATGG + Intronic
1001401496 5:171449027-171449049 GCCTGATTTTGGGGGAGTGAGGG + Intronic
1002082018 5:176743070-176743092 GCCCAGTGTTGGGGGATGGTGGG - Intergenic
1002301236 5:178258319-178258341 GCCTGGTGGTGAGGGACTGCAGG + Intronic
1002537420 5:179884837-179884859 GCCAGGGGCTGGGGGAGTGGGGG + Intronic
1002928127 6:1616813-1616835 GGCCGGGGTTGGGGGAGGGGGGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006131987 6:31875065-31875087 GTCAGGTGTTGGGGGAGGGGAGG + Intronic
1006186184 6:32182876-32182898 GCCCGGTGTCGGGGAAGGCCTGG + Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011598320 6:89037445-89037467 GCCTGGGGTTGGGGGAGGGGTGG - Intergenic
1012224424 6:96688332-96688354 GCCTGGGGTTGGGGGAGGGATGG - Intergenic
1013141115 6:107336002-107336024 GCCCGGGGTGGGGGGGGTGGGGG + Intronic
1017267686 6:152469079-152469101 GCCCTTTTTTGGGGGAGTGTGGG + Intronic
1018376788 6:163220206-163220228 GGGCGGGGGTGGGGGAGTGCAGG + Intronic
1019278994 7:191000-191022 CCCGGGTGTGGGGGGAGTCCTGG - Intergenic
1022296216 7:29056349-29056371 GCCAGGAGTTGGGGGAGGGAGGG - Intronic
1022542042 7:31146481-31146503 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1022845749 7:34208162-34208184 ACCCGGTGTTGTGGGACTGAGGG - Intergenic
1023818254 7:43966196-43966218 GCCAGGTGCTGGGGGACAGCAGG + Intergenic
1026740705 7:72976586-72976608 TCCCGGGGTTGGGGGTGTGGGGG - Intergenic
1026875507 7:73877047-73877069 ACCCGGAGTTTGGGGAATGCGGG - Intergenic
1027103027 7:75388485-75388507 TCCCGGGGTTGGGGGTGTGGGGG + Intergenic
1029149641 7:98470771-98470793 GCCCGCAGTTGGGGGCGTGGCGG - Intergenic
1029511406 7:100997666-100997688 GCTTGGTGTTGTGGGACTGCCGG - Exonic
1029511629 7:100999088-100999110 GCTTGGTGTTGTGGGACTGCCGG - Exonic
1029512126 7:101002337-101002359 GCTTGGTGTTGTGGGACTGCCGG - Exonic
1029512477 7:101004740-101004762 GCCTGGTGTTGTGGCAGTGCTGG - Exonic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033242269 7:139690060-139690082 GGGCGGGGGTGGGGGAGTGCGGG + Intronic
1034704340 7:153127273-153127295 GCCAGGAGTGGGGCGAGTGCAGG - Intergenic
1034911559 7:155002649-155002671 GCCCGGGCCCGGGGGAGTGCGGG - Intronic
1035303005 7:157909671-157909693 GCCCGATGTTGGGTGAGAACAGG - Intronic
1036637558 8:10562348-10562370 TACCGGTCTTGGTGGAGTGCAGG - Intergenic
1037354212 8:17999615-17999637 GCCTGGGGTTGGGGGAGGGGTGG + Intronic
1040554406 8:48466449-48466471 CCCCGGAGTGGGGGGAGCGCTGG - Intergenic
1040762154 8:50861817-50861839 GCACAGTGGTGCGGGAGTGCTGG - Intergenic
1041339704 8:56831466-56831488 GCCAGGTGTTGGCAGGGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045376930 8:101583499-101583521 GCCAAGTGTTGAGGGAGTGGAGG + Intronic
1045633203 8:104151565-104151587 TTCTGGAGTTGGGGGAGTGCAGG - Intronic
1045815582 8:106272241-106272263 GCCCGGCGTTGGGTGAGAGTGGG + Intronic
1045869232 8:106906471-106906493 GCCAGGTGTTGGAGGATTTCTGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1048987660 8:139743708-139743730 GCCCGGTGTTGGTGAAGGGCAGG - Intronic
1049222414 8:141434121-141434143 CCCAGGTGTTGGGGGGGTGGGGG + Intergenic
1049694861 8:143978167-143978189 GCCCTCTGTTGGAGGAGTCCAGG + Intronic
1050248112 9:3713345-3713367 GCCTGGGGTTGGGGGAGGGATGG - Intergenic
1051988854 9:23126100-23126122 GCCAGGTCTTGGGGGAGGGCAGG - Intergenic
1052204979 9:25828169-25828191 GCCTGGGGTTGGGAGAGTGATGG + Intergenic
1052837920 9:33265199-33265221 GCCCGGGGCTGGGGGTGGGCGGG - Intronic
1055257040 9:74384129-74384151 GCCCAGAGTTGGGGGAGGGCAGG + Intergenic
1056659490 9:88534269-88534291 GCACGGTGTGGGGGAAGCGCAGG + Intergenic
1058013604 9:100004647-100004669 GCCTGGGGTTGGGGGAGGGGTGG + Intronic
1059325446 9:113501516-113501538 TCCCGCTGCTGGGGGAGAGCTGG + Intronic
1060084192 9:120681486-120681508 GCCTGGGGTTGGGGGAGGGATGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060191738 9:121598391-121598413 GCCCGGGGTGAGGGGTGTGCAGG - Intronic
1060421526 9:123472787-123472809 GCCCCGTGTTATGGGAATGCAGG - Intronic
1060979298 9:127783474-127783496 GCCCCGAGATGGGGAAGTGCTGG + Intergenic
1061133624 9:128721523-128721545 GCCTGGTGCTGGGGGAGGGCAGG + Intronic
1062025666 9:134339076-134339098 GCCTGGTGTCGGGGCAGGGCTGG + Intronic
1062587775 9:137257176-137257198 GCTGGGTGGTGGGGGAGGGCTGG + Intronic
1203425647 Un_GL000195v1:34185-34207 TCCCGATGTTGGGGGAGCGTTGG + Intergenic
1185464499 X:346519-346541 GCCCGGTGTTGGGGGGACTCTGG - Intronic
1185673119 X:1827078-1827100 CCCCAGTGTTGGGGGGGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189411955 X:40780247-40780269 GCCCGGGGTTAGGGGAGGGGTGG + Intergenic
1190717466 X:53115737-53115759 GCCTGGGGTTGGGGGAGGGGTGG + Intergenic
1191663199 X:63671380-63671402 GTCAGGTGGTGGGTGAGTGCTGG - Intronic
1192539649 X:71957245-71957267 GGCTGGGGTTGGGGCAGTGCTGG + Intergenic
1192875316 X:75223299-75223321 GTCTGGTGTTGGGGGAGGGGTGG + Intergenic
1192941143 X:75912810-75912832 GCCTGGGGTTGGGAGAGTGGTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193742288 X:85231975-85231997 GCCTGGAGTTGAGGGAGTGGTGG - Intergenic
1194913950 X:99682024-99682046 GTCAGGTGTTGGGGGAGTAGAGG + Intergenic
1195331242 X:103802829-103802851 GCCTAGTGTTGGGGGTGTGAGGG - Intergenic
1198513133 X:137374299-137374321 GCCCGGGGGTGGGGGAGGGCGGG + Intergenic
1198683570 X:139205304-139205326 GGCCGGGGTGGGGGGAGCGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1202602919 Y:26612948-26612970 GGCAGATGTTGGGGGGGTGCAGG - Intergenic