ID: 1073804386

View in Genome Browser
Species Human (GRCh38)
Location 10:107081167-107081189
Sequence TGGATTCTTCTAGTATAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073804386_1073804390 11 Left 1073804386 10:107081167-107081189 CCTACCTATACTAGAAGAATCCA 0: 1
1: 0
2: 0
3: 8
4: 188
Right 1073804390 10:107081201-107081223 CTTTACAACTCAATGGATAATGG No data
1073804386_1073804389 4 Left 1073804386 10:107081167-107081189 CCTACCTATACTAGAAGAATCCA 0: 1
1: 0
2: 0
3: 8
4: 188
Right 1073804389 10:107081194-107081216 CATCAAACTTTACAACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073804386 Original CRISPR TGGATTCTTCTAGTATAGGT AGG (reversed) Intronic
901264144 1:7896867-7896889 TGTATTCTTTTAGTAGAGATGGG + Intergenic
905093365 1:35447828-35447850 TGAATTCTTCTAGGAGAGTTGGG - Intronic
905596573 1:39212794-39212816 TGTATTTTTTTAGTAGAGGTGGG + Intronic
907198489 1:52706279-52706301 TTGGTTTGTCTAGTATAGGTGGG - Intergenic
907257820 1:53193222-53193244 TGGATTTTTCTTGTGGAGGTAGG - Intergenic
909262347 1:73507724-73507746 TGTATTCTGCTATTATTGGTTGG - Intergenic
911132881 1:94408409-94408431 TGGATTTTTTTAGTAGAGATGGG - Intergenic
912418306 1:109526467-109526489 TGTATTTTTCTTGTAGAGGTGGG - Intergenic
918749289 1:188251980-188252002 TGGATTGTTCTAGTAGAGACGGG + Intergenic
921080246 1:211733344-211733366 TGGTTTCTTTTAGTAGAGATGGG + Intergenic
923481913 1:234393357-234393379 TGGCTTCCTCTAGTGGAGGTGGG - Exonic
924942541 1:248822025-248822047 TGGATTCTCTTAGTCTGGGTGGG - Intronic
1064093900 10:12408335-12408357 TGGATTTTTTTAGTAGAGATGGG + Intronic
1064436470 10:15315198-15315220 TGGATCCATCTAATATAGGAAGG + Intronic
1065282849 10:24157588-24157610 TGTTTTCTTCTAGTATACCTGGG + Intronic
1068341836 10:55714293-55714315 TGGATTCAGCGAGTAAAGGTAGG + Intergenic
1070047311 10:72851485-72851507 AGGATTCTTCAAGGATAGTTTGG + Intronic
1070289585 10:75105561-75105583 TGGATTCTTCCAGGATTGGTTGG - Intronic
1070346692 10:75550159-75550181 TGGATTCTGCTATTGTTGGTTGG + Intronic
1071215046 10:83391578-83391600 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1071547759 10:86541195-86541217 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1073804386 10:107081167-107081189 TGGATTCTTCTAGTATAGGTAGG - Intronic
1078821776 11:14890719-14890741 TGTATTCTTTTAGTAGAGATGGG + Intronic
1079911033 11:26310217-26310239 TGATTTCATCTATTATAGGTTGG - Intronic
1079943216 11:26708317-26708339 TCTATTCTTTTAGCATAGGTGGG + Intronic
1082057494 11:47831666-47831688 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1083101648 11:60313275-60313297 TGCATTCTTTTAGTAGAGATGGG + Intergenic
1084377702 11:68789571-68789593 GGGTTTCTTTTAGTAGAGGTGGG + Intronic
1084841936 11:71860046-71860068 AGGATTCTTCTCGTATCTGTGGG - Intergenic
1085679120 11:78554137-78554159 TGGAGCCTTGTAGTATAGTTGGG + Intronic
1089199886 11:116718112-116718134 TGGATTTTTTTAGTACAGATTGG + Intergenic
1090823939 11:130370226-130370248 TTGCTTCTTCTAGTAAAGTTAGG + Intergenic
1090956181 11:131514760-131514782 TGTATTCTTTTTGTAGAGGTGGG + Intronic
1093491438 12:19709623-19709645 TGACTTCTTCTAGTATGTGTTGG + Intronic
1093521335 12:20054099-20054121 TTGATTCTTCTAGTTTAGAAAGG - Intergenic
1095910477 12:47421154-47421176 TGTATTCTTCTGTTATTGGTTGG - Intergenic
1096369748 12:51059068-51059090 GGGATTCTTCTGGTAGAAGTTGG - Intronic
1096760643 12:53839241-53839263 AGGATTCTTCTAGGATTGCTGGG + Intergenic
1097461898 12:59872498-59872520 TGTTTTCCTCTAGTATTGGTTGG - Intergenic
1099252963 12:80280687-80280709 TGTAGTCTTGTAGTATAGTTTGG + Intronic
1103596416 12:122026889-122026911 TGGATTCTTGTAGTTTATATAGG + Intronic
1105497500 13:20943749-20943771 TGGATCCTTCTAGAAAAGGCTGG - Intergenic
1106209478 13:27628114-27628136 TGAATTCTTCTGATATGGGTTGG - Intronic
1107604418 13:42043510-42043532 TGGATTTTTTTTGTAGAGGTGGG + Intronic
1107780027 13:43890112-43890134 AGGATTCTTCTAGAACAGGGAGG + Exonic
1111554111 13:89857547-89857569 TGGAATCCCTTAGTATAGGTGGG + Intergenic
1114856455 14:26451540-26451562 TGTATTCTTTTAGTAGAGATGGG + Intronic
1115611190 14:35050178-35050200 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1116076589 14:40118969-40118991 TGGTTTCTTCTAATTTAGATAGG + Intergenic
1116078996 14:40148922-40148944 TGGAATCTTCTAGTAAAGCCAGG - Intergenic
1117551433 14:56840674-56840696 TGGATTCTTCTAGGATGCATTGG - Intergenic
1118561907 14:67094615-67094637 TGAATTCTACAAGTTTAGGTAGG - Intronic
1119070422 14:71577548-71577570 TGTATTCTTTTAGTAGAGGTGGG + Intronic
1120427571 14:84368650-84368672 AGTATTTTTTTAGTATAGGTTGG - Intergenic
1121702893 14:95969396-95969418 TGTATTCTTCTAGTGAAGGATGG + Intergenic
1124100833 15:26691082-26691104 AGGATTCTTTTAGCACAGGTTGG + Intronic
1125305269 15:38305155-38305177 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1127061005 15:55184370-55184392 TGGATTCTTATGGTATACATTGG - Intronic
1127079542 15:55363489-55363511 TGGCATCTTCTAATACAGGTAGG + Intronic
1128132816 15:65241005-65241027 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1129646396 15:77437743-77437765 TGTATTTTTCTAGTAGAGATGGG + Intronic
1130165874 15:81457537-81457559 TGTATTTTTATAGTATCGGTTGG + Intergenic
1132503412 16:294887-294909 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1137404911 16:48181784-48181806 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1141053878 16:80798212-80798234 TGTATTCTTTTAGTAGAGATGGG + Intronic
1142789554 17:2253314-2253336 TGTATTCTTTTAGTAGAGATGGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1146578710 17:34016660-34016682 TGGATCCTTCCAGTAAAGATAGG - Intronic
1146874327 17:36396266-36396288 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1146881678 17:36447181-36447203 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1147065059 17:37916605-37916627 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1147239679 17:39082387-39082409 TGTATTTTTCTAGTAGAGATGGG - Intronic
1147623009 17:41880687-41880709 TGTATTCTTTTAGTAGAGATGGG - Intronic
1147789742 17:43006364-43006386 TGTATTTTTTTAGTAAAGGTGGG + Intergenic
1148198880 17:45734722-45734744 TGGAGTCTTCTCCTATTGGTTGG - Intergenic
1149791117 17:59478334-59478356 TGTATTTTTCTAGTAGAGGCGGG - Intergenic
1150019133 17:61593066-61593088 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1153208728 18:2734894-2734916 TGTATTTTTCTAGTAGAGATGGG - Intronic
1154467643 18:14664841-14664863 TGGAGTCCCCTAGTCTAGGTTGG - Intergenic
1155253616 18:23974783-23974805 TGGAGCCTTGTAGTATAGTTTGG + Intergenic
1157065708 18:44347809-44347831 TGTATTTTTCTAGTATAGACGGG - Intergenic
1161003489 19:1923088-1923110 TGGATTCTTCCAGTACAGCCCGG + Exonic
1164090905 19:21951220-21951242 TGACTTCTTCCAGTATAGTTAGG - Intronic
1164110038 19:22147916-22147938 TGACTTCTTCCAGTATAGTTAGG - Intergenic
1164195028 19:22949056-22949078 TGACTTCTTCCAGTATAGTTAGG - Intergenic
1164769638 19:30798702-30798724 TGTATTTTTCTAGTAGAGATGGG - Intergenic
1165439625 19:35817449-35817471 TGTATTCTTTTAGTAGAGATGGG + Intergenic
925940570 2:8813748-8813770 TGTATTCTTTTAGTAGAGATGGG - Intronic
926856896 2:17266656-17266678 TGGATTTTTCCAGTTTATGTAGG - Intergenic
927178479 2:20427052-20427074 TGGTTTCATCTACTATAAGTGGG + Intergenic
928061619 2:28119121-28119143 TGTAGCCTTGTAGTATAGGTTGG + Intronic
928369874 2:30732954-30732976 TGGATGCTGCTAGTGTAGGTGGG + Intronic
928431224 2:31219921-31219943 TGGACTCTTCTAGAAGAAGTGGG - Intronic
928803537 2:35124368-35124390 TGTATTCTTTTAGTAGAGATGGG + Intergenic
928811295 2:35230298-35230320 TGGTTTCTTCTAGAATTGTTGGG + Intergenic
929075912 2:38078566-38078588 TGTATTTTTCTAGTAGAGATGGG + Intronic
929253986 2:39789908-39789930 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
934660334 2:96139911-96139933 TGTATTCTTTTAGTAGAGATGGG - Intergenic
934693194 2:96378108-96378130 TGGCTTCATGTAGTATAGATTGG + Intergenic
937695068 2:124799895-124799917 TGGATTCTTCAAGTCCAGATGGG - Intronic
938133940 2:128738495-128738517 TGGACTCTTCTACTTTAAGTGGG + Intergenic
938580446 2:132641139-132641161 TGCATTATTCTAGGATAGCTAGG + Intronic
942375205 2:175329281-175329303 TGGTTACTTCTAGTAGTGGTGGG + Intergenic
943442171 2:187938691-187938713 TGGATTTTTCTAGTTTAGATAGG - Intergenic
944032944 2:195259771-195259793 TGTATCTTTCTAGTATAGGAGGG - Intergenic
944226204 2:197351004-197351026 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
944805169 2:203273770-203273792 TGTATTTTTTTAGTAGAGGTAGG - Intronic
946988159 2:225297991-225298013 TGGATTTTTATACTATAGATTGG + Intergenic
947001500 2:225462469-225462491 TGGAGCCTTCTAGTCTGGGTGGG - Intronic
1169734241 20:8820730-8820752 TTTATTCTACTATTATAGGTGGG - Intronic
1172323252 20:34013870-34013892 TTGATACTTATAGTATAGTTTGG + Intronic
1172545780 20:35760290-35760312 TGTATTCTTTTAGTAGAGATGGG + Intergenic
1174262074 20:49303738-49303760 TGTATTTTTTTAGTAAAGGTGGG + Intergenic
1176806870 21:13492839-13492861 TGGAGTCCCCTAGTCTAGGTTGG + Intergenic
1177736962 21:25103030-25103052 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1181007103 22:20018906-20018928 TGTATTCTTTTAGTAGAGATGGG - Intronic
1182763524 22:32742098-32742120 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1182905497 22:33932325-33932347 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1183805597 22:40207937-40207959 TGTATTTTTCTAGTAGAGATGGG - Intronic
949428815 3:3950189-3950211 TGTATTTTTATAGTACAGGTAGG + Intronic
951501750 3:23395476-23395498 TGAATGCTTCTCGGATAGGTTGG - Intronic
960106706 3:113805740-113805762 TGGATTTTTTTAGTAGAGATGGG + Intronic
961747426 3:129073560-129073582 TGGATTTTTTTAGTAGAGATGGG + Intergenic
963800266 3:149669187-149669209 TGTATTGTTCTTGTATATGTGGG - Intronic
966835606 3:184047259-184047281 TGGATGATTCTAATATGGGTGGG - Intergenic
971522924 4:27577668-27577690 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
971902779 4:32683183-32683205 TGGATTTTTCAAGGATAGGTTGG - Intergenic
972188974 4:36568047-36568069 TGGCTTCTTCTCATTTAGGTAGG + Intergenic
972530165 4:39954490-39954512 TGTATTATTTTAGTAGAGGTGGG + Intronic
976150894 4:82090193-82090215 TTGGTTCTTTTAGTATATGTAGG - Intergenic
977192800 4:94021710-94021732 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
977585346 4:98769974-98769996 TTGATTCTTGTAGGATAAGTTGG - Intergenic
980014273 4:127630960-127630982 TACATTTTTCTAGTATAGGGAGG - Intronic
981264169 4:142761603-142761625 TGAATTTTTCTATTATAGGTTGG - Intronic
981712272 4:147721225-147721247 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
984892513 4:184506283-184506305 TGGTTTTTTCTAGTAGAGATTGG + Intergenic
991083220 5:62623787-62623809 TGTATTTTTCTAGTAGAGATAGG + Intronic
991639048 5:68735351-68735373 TGGATAGTGGTAGTATAGGTAGG + Intergenic
992409313 5:76489635-76489657 TGGATTTTTTTAGTAGAGATGGG + Intronic
992474852 5:77091466-77091488 TGTATTTTTCTAGTAGAGATGGG - Intergenic
995285827 5:110387131-110387153 TTGCTTCTTATGGTATAGGTGGG - Intronic
998881416 5:146649107-146649129 TGGCTTATGCTAGTGTAGGTAGG + Intronic
999026955 5:148243859-148243881 TGAGTTATTCTAGTATAGGTAGG - Intergenic
1002231623 5:177769048-177769070 TGGATTTCTTTAGTAGAGGTGGG - Intronic
1002406739 5:179039922-179039944 TGTATTTTTTTAGTATAGATGGG - Intergenic
1004853748 6:19727498-19727520 TGTATTTTTATAGTAGAGGTGGG - Intergenic
1005222348 6:23601220-23601242 TCCATTCTTCAAGTATGGGTGGG - Intergenic
1010203425 6:73302113-73302135 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1010969593 6:82249017-82249039 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1011362820 6:86546666-86546688 TGGATTTTTCTAGAATAATTTGG - Intergenic
1013123323 6:107159589-107159611 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1013136341 6:107286334-107286356 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1017642259 6:156505721-156505743 TGGATTCTTCTAGGAGAGAAAGG - Intergenic
1018506734 6:164478942-164478964 TAGAAGCTTCTAGTATAGGAAGG + Intergenic
1019375321 7:688227-688249 TGTATTTTTCTAGTAGAGATGGG - Intronic
1023588561 7:41757137-41757159 TGTAATCTTCTTGTATAGCTGGG + Intergenic
1023645628 7:42311242-42311264 TGGCTCCTTCAAGTATAGATTGG + Intergenic
1025205119 7:56988462-56988484 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1025666819 7:63588472-63588494 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1026782165 7:73275652-73275674 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1027022926 7:74828497-74828519 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1027064999 7:75116814-75116836 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1028418363 7:90604842-90604864 TGAATTTTTGTAGTATAAGTAGG + Intronic
1029992408 7:104974355-104974377 TGGATTCATGTAGTAGAGTTAGG + Intergenic
1032301440 7:130691033-130691055 TGTATTTTTTTAGTAGAGGTAGG + Intergenic
1032760897 7:134940516-134940538 TGGATCCTCCTACTAAAGGTAGG + Intronic
1032930050 7:136655879-136655901 TGGATTCGTCTAGTATATAAAGG - Intergenic
1033117545 7:138639079-138639101 TGTATTTTTTTAGTAGAGGTGGG - Intronic
1033331711 7:140422213-140422235 TGTATTTTTCTAGTAGAGATGGG - Intronic
1035006376 7:155664440-155664462 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1040003503 8:42598957-42598979 TGGCATCTTCTAGTAGAGATGGG - Intergenic
1044978659 8:97692901-97692923 TGTATTTTTTTAGTAGAGGTGGG + Intronic
1044985724 8:97754944-97754966 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1045826420 8:106403551-106403573 TGGATTCTACCAGTTTAGATAGG + Intronic
1046623747 8:116555953-116555975 TGCATTTTTTTAGTCTAGGTGGG + Intergenic
1047006560 8:120626054-120626076 GAGATTCTTCTAATGTAGGTGGG + Intronic
1047135539 8:122073912-122073934 TGCCTTCTTATAGTATAGATGGG + Intergenic
1048380532 8:133861337-133861359 TGGATTGTTTTAGTAGAGATGGG - Intergenic
1050226738 9:3466494-3466516 TGAAATCTATTAGTATAGGTTGG + Intronic
1052201431 9:25786013-25786035 TGTATTTTTTTAGTAGAGGTGGG + Intergenic
1052409920 9:28109987-28110009 TGTAGTCTTGTAGTATAGTTTGG - Intronic
1053367970 9:37537334-37537356 TGGATGCTCCTGGTAGAGGTGGG + Exonic
1053432130 9:38049435-38049457 TGCATTCTTTTAGTAGAGATGGG - Intronic
1055286326 9:74732029-74732051 TGTATTCTTCTATTAAAGGTGGG - Intronic
1058967792 9:110053352-110053374 TGTATTCTTTTAGTAGAGGCAGG - Intronic
1060614750 9:125002653-125002675 TGTATTCTTTTAGTAGAGATGGG + Intronic
1185666333 X:1768266-1768288 TGCATTTTTTTAGTAGAGGTGGG + Intergenic
1186512534 X:10140688-10140710 TGAATTCTAATAGTATAGATTGG + Intronic
1194165444 X:90508696-90508718 TGGTTTCTTCTCATTTAGGTAGG - Intergenic
1195024521 X:100862881-100862903 AGGATTCTTCTAGTCTAGTGGGG - Intronic
1195161227 X:102173750-102173772 TGTATTTTTTTAGTAGAGGTGGG - Intergenic
1195337867 X:103874723-103874745 TGACTTTTTCTAGTATAGTTAGG + Intergenic
1197286540 X:124601725-124601747 TGGCTACTGCTTGTATAGGTAGG + Intronic
1198002851 X:132457544-132457566 TGGATTCCTATACTGTAGGTAGG + Intronic
1198247561 X:134845192-134845214 TGGCTTCTTCCTGTAAAGGTAGG - Exonic
1200511712 Y:4086506-4086528 TGGTTTCTTCTCATTTAGGTAGG - Intergenic
1202034014 Y:20612588-20612610 TGACTTCTTCCAGTATAGTTGGG - Intergenic