ID: 1073805545

View in Genome Browser
Species Human (GRCh38)
Location 10:107093770-107093792
Sequence AGTGATAGGCAGATTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073805545_1073805548 2 Left 1073805545 10:107093770-107093792 CCTTACACAATCTGCCTATCACT 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1073805548 10:107093795-107093817 CTCTTCCACCATGATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073805545 Original CRISPR AGTGATAGGCAGATTGTGTA AGG (reversed) Intronic
900757358 1:4445816-4445838 AGTGAAAAGCAGCTTGTTTATGG - Intergenic
901006840 1:6175931-6175953 ATTGATAGGCGGATGGTGAACGG + Intronic
901692496 1:10982513-10982535 AGAGATGGGCAGATTGTTTGAGG + Intergenic
905130721 1:35754969-35754991 AGTGTTAAGCAGAGTGAGTAGGG - Intronic
905675206 1:39819743-39819765 AGTGAGAGGCAGGATGTGTTGGG + Intergenic
909591439 1:77353610-77353632 AGTGAGACGCAGAGTGGGTAAGG - Intronic
912184557 1:107259394-107259416 AGTGTTAGGAAGCATGTGTAAGG + Intronic
912714548 1:111973575-111973597 AGTGATAGCTAGATAATGTAGGG + Intronic
918580054 1:186115811-186115833 AGATATTGGCAGAATGTGTAGGG + Intronic
919062206 1:192647448-192647470 ATTGATAGTCATATTGTTTATGG - Intronic
1064360927 10:14663509-14663531 AGTGCTGGGCAGATTCTGCAGGG - Intronic
1064739981 10:18423068-18423090 AGTGATAGGAAGTGTGTGAATGG + Intronic
1065394578 10:25220616-25220638 AGGGCTAGGAAGATTGAGTAGGG - Intronic
1068638474 10:59374601-59374623 AGTGATAGGCAAATTATGTGTGG + Intergenic
1069594044 10:69659106-69659128 AGTGATGGGGAGATTGTGGTGGG + Intergenic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1072494041 10:95936725-95936747 AAATATAGGCAGATTGGGTAGGG + Intronic
1073104581 10:101025142-101025164 AGACAGAGGCAGATTTTGTAAGG + Intronic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1075567892 10:123518067-123518089 GGGGATAGGCAGCTTGTGTGGGG + Intergenic
1078251701 11:9622021-9622043 AGAGAAAGGGAGATTGTGAAAGG + Intergenic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1079341807 11:19617810-19617832 AGAGGAAGTCAGATTGTGTAGGG - Intronic
1080052340 11:27870177-27870199 TGTGAGACACAGATTGTGTAAGG - Intergenic
1080353568 11:31414409-31414431 ATAGGTAGGCACATTGTGTAAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1083205592 11:61146908-61146930 AGCGACAGGCAGAGTGTGTATGG + Intronic
1083628610 11:64084656-64084678 AGTGATGGGCAGGTTGGGCAGGG + Intronic
1084065484 11:66701503-66701525 AGTGAGAGGCAGGTTTTGTAGGG - Intronic
1087266476 11:96067017-96067039 TGTGGTAGGCAGATCTTGTAGGG + Intronic
1087866572 11:103235198-103235220 AATTAAAGGCAGATTGTGAAAGG - Intronic
1091800045 12:3319372-3319394 AGTGACAGTCAGATTGTGTGTGG + Intergenic
1092035230 12:5328768-5328790 GAAGATGGGCAGATTGTGTAAGG + Intergenic
1092993286 12:13924190-13924212 AGTAATAGGTATATTGTATATGG + Intronic
1095422244 12:42037157-42037179 AGTGATAAGCAGAATATATAAGG + Intergenic
1096821760 12:54241636-54241658 AGTGATAAGCACATTTTTTATGG + Exonic
1097596599 12:61640963-61640985 TGTGTTAGGTAGATAGTGTAAGG + Intergenic
1097771414 12:63590851-63590873 AGTGACAGGCCTGTTGTGTATGG - Intronic
1102615268 12:114148323-114148345 AGTCACAGGCAGATTTTGTGAGG + Intergenic
1104200930 12:126588129-126588151 AGAGAAAGGCAGATTATCTATGG + Intergenic
1105210753 13:18255472-18255494 AGCGATAGGCAGAGAGTGAATGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106093308 13:26619189-26619211 ACTTATAAGCAGGTTGTGTATGG - Intronic
1106111720 13:26783446-26783468 AGAGTGAGGCAGGTTGTGTAGGG - Intergenic
1115450198 14:33539106-33539128 AGGGAGAAGAAGATTGTGTAGGG + Intronic
1117367547 14:55044514-55044536 AGTGATACACAAATTGTTTAAGG + Exonic
1119127669 14:72142803-72142825 AGTGAAGGGCAGATGGTTTAAGG + Intronic
1119946244 14:78697844-78697866 AGTGATAGGAAGAATATGTCAGG - Intronic
1126389570 15:48132066-48132088 GGTAATAGGCAGATCATGTAAGG - Intronic
1126652345 15:50937562-50937584 AGTGTAAGGCAGAATGTGAAGGG + Intronic
1127572816 15:60261009-60261031 AGAGATAGCCAGATTGGGGAGGG + Intergenic
1127862321 15:63004513-63004535 AGTGATGAGCAGGTTGTGCATGG + Intergenic
1130399005 15:83531537-83531559 AGTGGCAGGCAGATCGTGGAAGG + Intronic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1145413940 17:22697210-22697232 AGTAATATGCAGAATGTGCAGGG - Intergenic
1146005403 17:29157566-29157588 AAAGTTAGGCAAATTGTGTAAGG - Intronic
1150016782 17:61565178-61565200 AGTGTTAGGCAGATTGTTTCCGG + Intergenic
1150919805 17:69470772-69470794 AGGGCTAGGCAGAATGTGTGAGG - Intronic
1151756420 17:76077725-76077747 AGAGGCAGGCAGATTGTTTAAGG + Intronic
1154117201 18:11621569-11621591 AGGTATAGATAGATTGTGTAAGG - Intergenic
1154299573 18:13181322-13181344 ATTGACATGCATATTGTGTATGG - Intergenic
1154408025 18:14114017-14114039 ATTGATAACCAGATTATGTAAGG - Intronic
1156884800 18:42122572-42122594 AATGATAGGAAGATTCTGAAAGG - Intergenic
1157190033 18:45573703-45573725 AGTGATAGGCAGATTGATGGAGG - Intronic
1162542991 19:11309373-11309395 GGTGACAGGTAGGTTGTGTAGGG - Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1165813970 19:38629862-38629884 GGTGACAGGCAGATTCTGTGTGG + Intronic
1166877915 19:45909112-45909134 GGTGAGAGGCAGATTGTGTGGGG + Intergenic
1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG + Intergenic
925046866 2:778806-778828 TGTGATAAGCAGATAGTGTGAGG - Intergenic
926340143 2:11898636-11898658 AGTGTTAGGGAGAGTGTGTGTGG + Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
931402591 2:61944712-61944734 AGTGATGGGCAGATTCTTTTAGG - Intronic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
934605894 2:95694855-95694877 GGGGAGAGGCAGATTTTGTAGGG + Intergenic
934621292 2:95809980-95810002 ATTTATTGGCAGATTGTGAAGGG + Intergenic
935507862 2:103929812-103929834 AGGGAAAGGCAGACTGTGTCAGG - Intergenic
936539302 2:113337058-113337080 GGGGAGAGGCAGATTTTGTAGGG + Intergenic
939076566 2:137609554-137609576 AGGTGTAGGCAGATAGTGTAAGG + Intronic
945270636 2:207935772-207935794 AGTGATAAGCTGATAGAGTATGG - Intronic
946326427 2:218986787-218986809 AGTGGGAGGCAGAGTGTGGAGGG + Intergenic
1171291895 20:23987161-23987183 AGCGATAGGCAGAGAGTGAATGG + Intronic
1172250310 20:33474834-33474856 AGGGATAGGCAGACCGTGTGCGG + Intergenic
1173124361 20:40323003-40323025 ATTCATAGGCACATTGTCTATGG + Intergenic
1175024662 20:55889147-55889169 AGTGTGAGCCAGATTGTGCAGGG + Intergenic
1177267856 21:18807855-18807877 TGTGAATGCCAGATTGTGTATGG + Intergenic
1180765502 22:18343945-18343967 AGCGATAGGCAGAGAGTGAATGG - Intergenic
1180780815 22:18518447-18518469 AGCGATAGGCAGAGAGTGAATGG + Intergenic
1180813528 22:18775754-18775776 AGCGATAGGCAGAGAGTGAATGG + Intergenic
1180882827 22:19218669-19218691 GGTGCTAGGCAGACTGTTTAGGG - Intronic
1181199712 22:21210084-21210106 AGCGATAGGCAGAGAGTGAATGG + Intronic
1181400050 22:22645774-22645796 AGCGATAGGCAGAGAGTGAATGG - Intronic
1181702024 22:24626872-24626894 AGTGATAGGCAGAGAGTGAATGG - Intronic
1203227123 22_KI270731v1_random:84835-84857 AGCGATAGGCAGAGAGTGAATGG - Intergenic
1203263628 22_KI270734v1_random:1436-1458 AGCGATAGGCAGAGAGTGAATGG + Intergenic
949360117 3:3222618-3222640 AGTGACAGCCAGATAGTGAAGGG + Intergenic
951054905 3:18136337-18136359 AGAGAGAGGGAGCTTGTGTAGGG + Intronic
951426328 3:22550240-22550262 AGTTATATGCAGATTATGTGAGG + Intergenic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
956912200 3:73829711-73829733 AATGATGAGCAGATTGGGTATGG - Intergenic
959900064 3:111650929-111650951 AGTGATAGGCAAATTCTGTGTGG + Exonic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963494294 3:146040964-146040986 AATGATAGCCATATTGTTTATGG - Intergenic
964230705 3:154463904-154463926 ACTGAAAGACAGATTGTCTAAGG - Intergenic
964309689 3:155379544-155379566 TGTGTAAGGAAGATTGTGTAAGG + Intronic
966960131 3:184927252-184927274 ATTGATAGCCAGATTTTGTCAGG + Intronic
967816251 3:193800866-193800888 TGTGATCTGCAGATTGTGAAGGG + Intergenic
969166263 4:5318360-5318382 AGTGATAGGAAGATGGAGCAGGG + Intronic
969257130 4:6009852-6009874 AGTGATAGGGAAATTGCTTAGGG - Intergenic
973265725 4:48208422-48208444 AGTAACAGGCAGATTTTGGAGGG - Intronic
979795190 4:124837742-124837764 ACTGATACGCAGACTATGTAAGG - Intergenic
986550953 5:8955035-8955057 AGTGATAAGCAGTTTGAGAAAGG + Intergenic
986732755 5:10647594-10647616 AGTGTCAGGGAGACTGTGTAAGG + Intronic
988114181 5:26862683-26862705 AGTTGGAGGCAGATTGTCTAGGG + Intergenic
990701656 5:58481201-58481223 AGTGAGAGACAATTTGTGTAGGG + Intergenic
990701675 5:58481438-58481460 AGTGAGGGGCAGCATGTGTAGGG + Intergenic
990701707 5:58481662-58481684 AGTGAGGGGCAGCCTGTGTAGGG + Intergenic
990701718 5:58481718-58481740 AGTGAGGGGCAGCATGTGTAGGG + Intergenic
990998991 5:61764130-61764152 ACTGCTAGGGAGATTGTATAGGG - Intergenic
994800231 5:104364174-104364196 AGTGGTAGGAAGTTTGTGGAAGG + Intergenic
999082331 5:148856238-148856260 AGTGATTGGCATTTTGTGTAGGG - Intergenic
1001149020 5:169210603-169210625 AGTGGTATGCAGAATGTGTTGGG + Intronic
1002292510 5:178209540-178209562 AGGGGTGGGCAGATTGTGTGAGG + Intronic
1004165988 6:13256879-13256901 AGAGATTGGAAGAGTGTGTAGGG - Intronic
1005297160 6:24437646-24437668 AGTGGGAGTCAGATTCTGTAAGG - Intronic
1008563793 6:52748069-52748091 AGAGACAGGCAGAGTGTGTGGGG + Intergenic
1009929990 6:70165716-70165738 AGTGAGAGTCAGAATGGGTATGG + Intronic
1013469575 6:110449910-110449932 AGAGAAGGGCAGATTGTGAAAGG - Intronic
1017842672 6:158233672-158233694 AGTGATAGCCATATTCTGAATGG + Intronic
1019629334 7:2039062-2039084 AGTGATAGACAGCCTGTGGATGG - Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020701100 7:11484462-11484484 AGTGACTGGGAGAGTGTGTATGG - Intronic
1020882486 7:13779243-13779265 AGTGCTAGGCAGATTTTGAGTGG + Intergenic
1020937627 7:14487075-14487097 CGTGGTGGGCAGAGTGTGTAGGG + Intronic
1022931011 7:35114631-35114653 AGTGACAGGCCTGTTGTGTAGGG - Intergenic
1024477903 7:49833384-49833406 AGTGATTGGCTTATTGTGCAAGG - Intronic
1031363182 7:120871427-120871449 AGTGTTTGGCCGATAGTGTAGGG - Intergenic
1033941841 7:146664391-146664413 TGAGATGGGCAGATTGTTTAAGG - Intronic
1034010907 7:147528441-147528463 AGTGAGAGACAGAATGAGTAAGG - Intronic
1035088977 7:156289103-156289125 AGAGAGAGGCAGAATGTGTTTGG - Intergenic
1036000126 8:4593194-4593216 AGCAAAAGGCAGATTCTGTAGGG - Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1036507123 8:9366040-9366062 AGTGCTAGGCAGGTTGTACATGG + Intergenic
1038589850 8:28826733-28826755 TGGGCTAGGCAGATTGAGTAGGG - Intronic
1040391258 8:46952727-46952749 AGTGATAGGCAGAGAGCGTGAGG - Intergenic
1041070225 8:54121408-54121430 ATTGATCGGCACATTGTGTGAGG - Intergenic
1041277405 8:56176981-56177003 ATTTATAGGCAGATTCAGTATGG - Intronic
1042113067 8:65402242-65402264 AGTGGAAGGCAGAGTGTGTCTGG - Intergenic
1043632805 8:82357634-82357656 TGAGATAGGGAGATTGTTTAGGG - Intergenic
1044689524 8:94862713-94862735 AGTGAGAGGCCAATTATGTATGG - Intronic
1046157986 8:110319144-110319166 AGTGCTAGGGAGAATGTCTAAGG - Intergenic
1047472673 8:125193804-125193826 AGTGATAGGCAGAGACTGAAGGG - Intronic
1049344756 8:142132895-142132917 GGTGACAGGCAGGTTGAGTAGGG + Intergenic
1053460714 9:38268643-38268665 ATTAATAACCAGATTGTGTAAGG + Intergenic
1060712752 9:125886102-125886124 AGTGATGGGTAGATAGTGCATGG + Intronic
1185923508 X:4120671-4120693 AGTGATAAGCAGCTTGAGTTGGG - Intergenic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189600362 X:42617517-42617539 AATGGCAGGCAGATTGTGGAGGG - Intergenic
1193872677 X:86820968-86820990 AGTGATAGTAAGAGTGTGAAAGG + Intronic
1194441050 X:93934797-93934819 ATTAATAGTCAGAATGTGTAAGG - Intergenic
1196549838 X:117010701-117010723 AGTTCCAGGCAGAATGTGTATGG + Intergenic
1201903983 Y:19071085-19071107 AGCAATGGGAAGATTGTGTAGGG - Intergenic