ID: 1073806824

View in Genome Browser
Species Human (GRCh38)
Location 10:107107593-107107615
Sequence TTGCTGTGGGAGATACAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073806824_1073806831 20 Left 1073806824 10:107107593-107107615 CCTAATTGTATCTCCCACAGCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG No data
1073806824_1073806832 28 Left 1073806824 10:107107593-107107615 CCTAATTGTATCTCCCACAGCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1073806832 10:107107644-107107666 AATAGCCTTTGTGGGAACCTTGG No data
1073806824_1073806830 19 Left 1073806824 10:107107593-107107615 CCTAATTGTATCTCCCACAGCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1073806830 10:107107635-107107657 CACAGACAAAATAGCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073806824 Original CRISPR TTGCTGTGGGAGATACAATT AGG (reversed) Intronic
904045956 1:27608407-27608429 CTGCTCAGGGAGTTACAATTAGG - Intergenic
905246420 1:36617610-36617632 TTGATGTTGGAGATACAGTGAGG + Intergenic
907038201 1:51235446-51235468 TTTCTGTGAGAGAAACAATATGG + Intergenic
907205241 1:52764661-52764683 GTCCAGTGGGAGACACAATTAGG + Intronic
910649831 1:89554623-89554645 TTGCTGTTGGTGACACAAGTTGG + Intronic
918098432 1:181353215-181353237 ATGCTGTGGGATATATAAATGGG - Intergenic
920245987 1:204587954-204587976 TGGCTGGGGGAGATATAATCAGG - Intergenic
921535537 1:216344938-216344960 TGGCTGTGGGTGACATAATTAGG + Intronic
922362390 1:224835281-224835303 TTGCTGAGAGAGATACTGTTGGG - Intergenic
924643317 1:245854248-245854270 GTGGTGGGGGAGGTACAATTTGG + Intronic
1063567502 10:7183774-7183796 TTGCTTTGGGAAAGACAAATTGG - Intronic
1063811479 10:9713663-9713685 TTGTTGTGGGGGATATAAGTGGG + Intergenic
1065362227 10:24899241-24899263 ATGTTGTGGGAGACACAAATTGG - Intronic
1065420188 10:25534807-25534829 TTGAGGTGGGAGATGTAATTCGG - Intronic
1069250463 10:66260059-66260081 GTGCTTTGGGAGAGACAATGGGG - Intronic
1071297297 10:84231353-84231375 TTGCTTTGGCAGATAGAATATGG + Intergenic
1071835979 10:89417294-89417316 TTGAGGTAGAAGATACAATTGGG + Exonic
1073806824 10:107107593-107107615 TTGCTGTGGGAGATACAATTAGG - Intronic
1073833495 10:107414056-107414078 TTGCTTTCGGAGCTACAATTGGG - Intergenic
1080994197 11:37580339-37580361 TGGCTGTGAGGGATAGAATTAGG + Intergenic
1082647301 11:55743679-55743701 TGGCTTTGGGACAGACAATTAGG - Intergenic
1082999843 11:59281282-59281304 TGGCTGTGGGAGAAACATATTGG - Intergenic
1083123902 11:60544308-60544330 TTGTTCTGGGAGATATGATTAGG - Intergenic
1084354557 11:68628923-68628945 TTGCTGTGAGAGACAGAATTTGG - Intergenic
1085506054 11:77060158-77060180 TTGCTGGTGGGAATACAATTTGG - Intergenic
1085727423 11:78966480-78966502 AAGGTGAGGGAGATACAATTAGG + Intronic
1086135934 11:83444024-83444046 TTGCTGTGAGAGACAGAAGTTGG + Intergenic
1086534680 11:87830573-87830595 TTGTTGTGGGAAATAAAATAAGG - Intergenic
1088282167 11:108146338-108146360 TTTCTCTGGGACATCCAATTGGG + Exonic
1097540522 12:60936771-60936793 TTGCTGTGGGTGAAGAAATTGGG - Intergenic
1097722927 12:63043291-63043313 TGACTGTGTGAAATACAATTCGG - Intergenic
1097935908 12:65250831-65250853 TGTCTGAGGGAGGTACAATTTGG + Intergenic
1098074655 12:66716014-66716036 TTGCTGTTGGTGATATATTTAGG + Intronic
1098161616 12:67650819-67650841 TTCCTGTGGAAAATCCAATTGGG - Intronic
1103051351 12:117782631-117782653 TTGCTGTGAGAATTACAATGAGG - Intronic
1104193771 12:126510537-126510559 TTTCTGTGGGAGTTTCATTTCGG - Intergenic
1104206622 12:126644724-126644746 TTGCTTTGAGAGATATAAATGGG - Intergenic
1106096794 13:26653351-26653373 TTGCTGTGGGAGCAAGAAATGGG - Intronic
1106098540 13:26672971-26672993 TGGCTTTGGGAGATTTAATTGGG + Intronic
1106332713 13:28754273-28754295 TTGCAGTGGGAGACAGAAATTGG - Intergenic
1106510320 13:30407584-30407606 TTGCTATGTGAGATACACTCTGG + Intergenic
1107073727 13:36298786-36298808 TTGGTGTGGAAAACACAATTTGG + Intergenic
1109353247 13:61209398-61209420 TTGCTGTGAGAGACAGAAGTTGG - Intergenic
1111016653 13:82389950-82389972 TGCCTATGGGAGATAGAATTTGG - Intergenic
1111396561 13:87674164-87674186 TTCCTGTGGGAGATGAAATTCGG + Intronic
1114233233 14:20802444-20802466 TGGATGTCGGGGATACAATTTGG - Intronic
1116184383 14:41578007-41578029 TGGCTGGGGAACATACAATTGGG - Intergenic
1119842878 14:77806630-77806652 TTACTGTGGGAGAGACACCTAGG - Intronic
1121928395 14:97949437-97949459 TTTCTGTGGGTGGTTCAATTGGG - Intronic
1123579482 15:21703529-21703551 TTCCTGTGGGAGACACAGTGAGG + Intergenic
1123616109 15:22146040-22146062 TTCCTGTGGGAGACACAGTGAGG + Intergenic
1126255188 15:46617070-46617092 ATGCTCTGGGAGATACAATGTGG - Intergenic
1127288076 15:57547729-57547751 GTGTTGTGAGAGATACACTTTGG + Exonic
1131302691 15:91213316-91213338 TGGCAGTGGGAGATGCAGTTAGG + Intronic
1131671729 15:94626885-94626907 TGGCTCTGAGAGATACAACTAGG + Intergenic
1132172562 15:99676168-99676190 ATACTGTGGCAGATATAATTAGG - Intronic
1132290842 15:100702863-100702885 TAGCTGTGGCAAATACAACTGGG - Intergenic
1202988352 15_KI270727v1_random:437774-437796 TTCCTGTGGGAGACACAGTGAGG + Intergenic
1133326900 16:4947415-4947437 TTGCTGTGGGAGACAGGAGTGGG + Intronic
1138020175 16:53471920-53471942 GTGCTGTGGGAGGTAGAATGGGG - Intronic
1139035374 16:62939677-62939699 TTGCTATGGGAGATGAAATGAGG + Intergenic
1142864891 17:2784823-2784845 TTGCTGATGGAGATACCATGAGG + Intronic
1143830703 17:9648179-9648201 TTAATGAGGGAGATACAATCTGG + Intronic
1153518734 18:5931710-5931732 ATGCTATGGGAGAAATAATTTGG - Intergenic
1153631116 18:7070936-7070958 TTGCAGTGGCTGATAGAATTGGG - Intronic
1165006761 19:32813742-32813764 TGGCTTTGGGAAATACAGTTTGG + Intronic
925150767 2:1613112-1613134 TTTCTGTGGGTGATCTAATTGGG + Intergenic
925437478 2:3852706-3852728 TTACTGTGGGAGATCCCATAAGG + Intergenic
925927895 2:8683441-8683463 CTGCTGTTGGAGATCCAAATAGG + Intronic
926349153 2:11979789-11979811 TTGCTGATGGAGAGACAAGTAGG - Intergenic
928030547 2:27774776-27774798 GTGCTGTGAGAGAAACAATCAGG + Intronic
929793590 2:45041391-45041413 TTGATGTGGGAAAAACAACTGGG + Intergenic
934052696 2:88223634-88223656 TGGCTGTGGGAGAAACAGCTGGG + Intergenic
934917249 2:98310204-98310226 TTGCTGAGAGAGAGACACTTAGG + Intronic
936140761 2:109938286-109938308 TGGCTGTGTGAGATACAGTCAGG - Intergenic
936177452 2:110236231-110236253 TGGCTGTGTGAGATACAGTCAGG - Intergenic
936203932 2:110433200-110433222 TGGCTGTGTGAGATACAGTCAGG + Intronic
937793032 2:125982462-125982484 TTGCTATGGGAGATAGAATCAGG - Intergenic
937921674 2:127135959-127135981 TTGGTGTTGGAGGTACAATAGGG - Intergenic
938971087 2:136433428-136433450 TTGCTGTGGAAGATTCAGCTTGG + Intergenic
939843860 2:147220497-147220519 TGGCTGTGGGTGACAGAATTAGG - Intergenic
940811357 2:158246310-158246332 TTACTGTTGGAGATACATTTTGG - Intronic
941242859 2:163062598-163062620 TTGCTTTGGAAGATCCAAGTTGG + Intergenic
942643080 2:178080785-178080807 TTGCTGTGGAAGTTACTCTTGGG - Intronic
943051971 2:182923834-182923856 TTGCTGTATGAGAAAAAATTTGG + Intronic
948978151 2:241476840-241476862 TTGCTGTGGGGGTTTCACTTTGG - Intronic
1171751450 20:29053857-29053879 TTTCTGTGAGAGATACCATTGGG + Intergenic
1175359833 20:58400345-58400367 GTGCTGTGGGAAATACAAGCTGG - Intronic
1176313328 21:5217087-5217109 TTTCTGTTGGAGATACCATTGGG - Intergenic
1176741859 21:10612088-10612110 GTGCTGAGGGAAATACAGTTTGG - Intergenic
1179682654 21:43035217-43035239 TTGCTGTGGGAGATAAAGAATGG - Intergenic
1180039139 21:45266951-45266973 TTGCTGTGGGAGGTACGCCTGGG - Intronic
1180563737 22:16645325-16645347 GTGCTGAGGGAAATACAGTTTGG - Intergenic
1181437051 22:22917174-22917196 TTGCTGTGGGGAATACTGTTGGG + Intergenic
1182668431 22:31975610-31975632 GGGTTGTGGGAGATACATTTTGG + Intergenic
950315215 3:11996043-11996065 AAGCTGTGGGTGATACAATCAGG + Intergenic
952035097 3:29190639-29190661 TTTCTGTGGGAGAGAAACTTAGG - Intergenic
954057133 3:48036147-48036169 TTGCTGTGAGAGACAATATTTGG - Intronic
958183949 3:90095466-90095488 TTGCAGTGGGACTTGCAATTAGG - Intergenic
959451586 3:106510372-106510394 ATGTTTTGGGAGAGACAATTTGG - Intergenic
961254352 3:125534846-125534868 TAGCTGTGGGAGAGGCTATTTGG + Intronic
963693408 3:148534490-148534512 TTGCCATAGGAGTTACAATTGGG + Intergenic
966450514 3:180054529-180054551 TTTATGTTGGAGATATAATTAGG - Intergenic
970205593 4:13652678-13652700 TTGCTATGGTGGATACAACTGGG - Intergenic
970457758 4:16242288-16242310 TTGCTGTTGGATATAGAATTGGG - Intergenic
971371924 4:26026966-26026988 TTTCTGTAGAAGAAACAATTTGG + Intergenic
972109952 4:35545138-35545160 TTGCTTTATGAAATACAATTGGG - Intergenic
974805456 4:66874176-66874198 TTGGTGGGGCAGATAGAATTAGG - Intergenic
977995691 4:103495840-103495862 GTGCTGTGGGAGAGACACTGTGG + Intergenic
979387665 4:120088389-120088411 GTGTTGTGGGAGATACCAGTGGG - Intergenic
981726757 4:147855983-147856005 TTGCTTTGGAAAATACAAGTTGG + Intronic
982864082 4:160488623-160488645 TGGCTGTGGGTGATAGGATTAGG + Intergenic
983848835 4:172554134-172554156 TTGGGGTGGGAGTTAGAATTGGG - Intronic
984147671 4:176083676-176083698 TTGCTGTTGGCTATACACTTAGG + Intronic
984559193 4:181248754-181248776 TTGCTGTGATAGATATAAGTTGG - Intergenic
985203811 4:187511023-187511045 TTCCTGGGAGAGATGCAATTAGG + Intergenic
986520477 5:8612104-8612126 TTGCTGTGGCAGAAACTTTTTGG - Intergenic
986927929 5:12781535-12781557 TTGCTTTGAGAAATACAATAAGG - Intergenic
988848341 5:35153275-35153297 TTGCTGAGAGAACTACAATTTGG + Intronic
988890407 5:35610427-35610449 TTGCTGTGGTAGTTACAATCAGG + Intergenic
989115313 5:37946829-37946851 TTTCTGTGGGAGATAGAAATTGG + Intergenic
989823356 5:45823066-45823088 TTGCTGTTTGAAATTCAATTTGG - Intergenic
993210415 5:84942917-84942939 TTGCTGTTGGGTATGCAATTTGG - Intergenic
993764141 5:91834343-91834365 TTGCTGTGCAAGAGACACTTTGG - Intergenic
993934480 5:93984990-93985012 TTCCTGTAGGAGATAGAATGAGG - Intronic
994275124 5:97827266-97827288 TTGCTTTTGGAGATACAAAATGG - Intergenic
997390422 5:133510620-133510642 TTGGAGTGGGAGATAAAATCTGG - Intronic
999240253 5:150123280-150123302 TGGATGTGGGAGAGACACTTTGG + Intronic
999555518 5:152738408-152738430 TTGTTGTGGGGGATACAAACAGG - Intergenic
999563763 5:152834579-152834601 TTTTTGTTGGAGATAGAATTTGG + Intergenic
1000440047 5:161253093-161253115 TTGCTGTGAGAGACAGAAGTTGG - Intergenic
1004432367 6:15556520-15556542 TGGCTGTGGGTGACAGAATTGGG + Intronic
1007122533 6:39395140-39395162 TTGCTGTGGGATATTCACTTGGG + Intronic
1013036711 6:106392142-106392164 TGGCTGTGGGAGTTACAATGGGG + Intergenic
1013847326 6:114469017-114469039 GCACTATGGGAGATACAATTTGG + Intergenic
1014473870 6:121848964-121848986 CTGCTGAGGTAGATACAATAAGG + Intergenic
1014494926 6:122109733-122109755 TTGATCTTAGAGATACAATTTGG - Intergenic
1015672824 6:135709554-135709576 TGGCTGTAGGAGGTACAACTTGG + Intergenic
1016494068 6:144639791-144639813 TTGCTGTGGGAGTTTCTATATGG + Intronic
1017727244 6:157284124-157284146 GTGCTGTGGGAGGTGCATTTGGG + Intergenic
1018959745 6:168440199-168440221 TTTCTGTGTGAGACAGAATTAGG + Intergenic
1019865269 7:3702976-3702998 TTGCTGGTGGAGATATAAATTGG + Intronic
1020540790 7:9459641-9459663 TTGCTGTGAGAGACAGAAGTTGG + Intergenic
1023614838 7:42009451-42009473 TTGCTGGGGGAGATAGAAAGTGG - Intronic
1024390714 7:48808696-48808718 TTGCTCAGGGAGAGACTATTTGG + Intergenic
1026412028 7:70133178-70133200 TTGCTTTGGGAGCTGCATTTAGG + Intronic
1026939213 7:74277171-74277193 TTGCTGTGCTAGATACTGTTGGG + Intergenic
1027427903 7:78080691-78080713 TTGCTGTTGGACAGACAATGAGG - Intronic
1028249419 7:88523449-88523471 TTGCTGAAGGAGATGTAATTAGG + Intergenic
1028569957 7:92276249-92276271 TTGCTGGTGGAGGTACAACTTGG - Intronic
1029164549 7:98578038-98578060 TTGCTGGGGGGGAGACATTTGGG - Intergenic
1031777679 7:125922190-125922212 TTGCTGTGAGAGACAGAAGTTGG - Intergenic
1033009196 7:137601351-137601373 TTGCTATGGGTGATAAAATGGGG - Intronic
1038395781 8:27244508-27244530 TTGCTGTGGGACACAGAAATAGG + Intronic
1039997417 8:42545859-42545881 TTCCTCTGGGTGTTACAATTTGG + Intronic
1041888281 8:62839055-62839077 TAGCTGTGTGAGATAGGATTGGG - Intronic
1046590063 8:116195610-116195632 TTTGTGTGGGATAGACAATTTGG - Intergenic
1046598886 8:116294654-116294676 TTGCTGTGGGAGTTGCATTTTGG + Intergenic
1047709330 8:127535538-127535560 TTGCTGTGGGTGATGCACTGAGG + Intergenic
1048260597 8:132941892-132941914 GTGCTGTGGAAGACACAACTTGG - Intronic
1050064502 9:1744688-1744710 TTGCCATGGCATATACAATTTGG + Intergenic
1051153250 9:14109264-14109286 TTTCTCAGGGAGATAAAATTTGG + Intronic
1051225303 9:14892617-14892639 TGGCTGTGGGTGACAGAATTAGG + Intronic
1053722934 9:40966349-40966371 TTTCTGTGAGAGATACCATTGGG + Intergenic
1054343034 9:63885651-63885673 TTTCTGTGAGAGATACCATTGGG - Intergenic
1055983601 9:82032275-82032297 TTGCTGTGGGGCATACTGTTAGG + Intergenic
1056497266 9:87170566-87170588 TTTCTGTGGGAAAGACAAGTGGG + Intergenic
1056728314 9:89142051-89142073 TGGCTGTGGGCGACAGAATTAGG - Intronic
1057439336 9:95071585-95071607 TTGCCGTGGAAGAGACAATGAGG + Intronic
1058211907 9:102179257-102179279 TTGCTTTGGTAAATACAGTTAGG - Intergenic
1059976187 9:119719920-119719942 TGGCTGTGGGAGGGATAATTGGG - Intergenic
1061418420 9:130460657-130460679 TTGCTGTGGGGGAGGCAATAGGG + Intronic
1203452224 Un_GL000219v1:129636-129658 TTTCTGTGAGAAATACCATTGGG - Intergenic
1186750739 X:12619389-12619411 TTGCTATGGGGGATACCAGTGGG - Intronic
1188055052 X:25531083-25531105 TTGCTTTGGCTGATACAATGTGG + Intergenic
1189520853 X:41766209-41766231 TTCCTGTGGGATATACCCTTCGG + Intronic
1191005908 X:55711450-55711472 TTGCTGTGGGTGACAGGATTAGG - Intergenic
1191761648 X:64653683-64653705 TTGCTGTGAGAGACAGAAGTTGG - Intergenic
1193315342 X:80058377-80058399 TGGCTGTGGGTGACAGAATTAGG - Intergenic
1194317567 X:92399359-92399381 TTGGTGTGGGGGCTACACTTTGG + Intronic
1194371771 X:93082690-93082712 GTGCTGTGGGAGAGACCAGTGGG - Intergenic
1194593128 X:95825544-95825566 TTGCTGTTGGAAATACAAAATGG + Intergenic
1197947724 X:131858742-131858764 TTGCTAAGGGACATACATTTAGG + Intergenic
1198123355 X:133617610-133617632 TTGCTTAGGAAGATACTATTTGG - Intronic
1200625744 Y:5512644-5512666 TTGGTGTGGGGGCTACACTTTGG + Intronic
1200679814 Y:6196740-6196762 GTGCTGTGGGAGAGACCAGTGGG - Intergenic
1201937478 Y:19423751-19423773 TTGCTGTGAGAGACAGAAGTTGG - Intergenic
1202076183 Y:21040018-21040040 TTGCTGTGAGAGACAGAAGTTGG + Intergenic
1202600182 Y:26586278-26586300 GTGCTGAGGGAAATACAGTTTGG - Intergenic