ID: 1073806826

View in Genome Browser
Species Human (GRCh38)
Location 10:107107607-107107629
Sequence CTGAAAAATTATTGTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073806826_1073806832 14 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806832 10:107107644-107107666 AATAGCCTTTGTGGGAACCTTGG No data
1073806826_1073806834 25 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806834 10:107107655-107107677 TGGGAACCTTGGATTAATTTAGG No data
1073806826_1073806835 28 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806835 10:107107658-107107680 GAACCTTGGATTAATTTAGGAGG No data
1073806826_1073806830 5 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806830 10:107107635-107107657 CACAGACAAAATAGCCTTTGTGG No data
1073806826_1073806831 6 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073806826 Original CRISPR CTGAAAAATTATTGTTGCTG TGG (reversed) Intronic
No off target data available for this crispr