ID: 1073806831

View in Genome Browser
Species Human (GRCh38)
Location 10:107107636-107107658
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073806826_1073806831 6 Left 1073806826 10:107107607-107107629 CCACAGCAACAATAATTTTTCAG No data
Right 1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG No data
1073806824_1073806831 20 Left 1073806824 10:107107593-107107615 CCTAATTGTATCTCCCACAGCAA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG No data
1073806825_1073806831 7 Left 1073806825 10:107107606-107107628 CCCACAGCAACAATAATTTTTCA 0: 2
1: 0
2: 4
3: 53
4: 400
Right 1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr