ID: 1073812397

View in Genome Browser
Species Human (GRCh38)
Location 10:107164825-107164847
Sequence GGACGCGGCGCCCGGAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073812397_1073812403 3 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812403 10:107164851-107164873 GGCCGAGCTGCGCTGCGCACCGG No data
1073812397_1073812404 4 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812404 10:107164852-107164874 GCCGAGCTGCGCTGCGCACCGGG No data
1073812397_1073812408 18 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812408 10:107164866-107164888 CGCACCGGGTCTCCGGGCGCTGG No data
1073812397_1073812412 30 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812412 10:107164878-107164900 CCGGGCGCTGGAGGCGCCGCCGG No data
1073812397_1073812407 12 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812407 10:107164860-107164882 GCGCTGCGCACCGGGTCTCCGGG No data
1073812397_1073812406 11 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812406 10:107164859-107164881 TGCGCTGCGCACCGGGTCTCCGG No data
1073812397_1073812409 21 Left 1073812397 10:107164825-107164847 CCGGGACTCCGGGCGCCGCGTCC No data
Right 1073812409 10:107164869-107164891 ACCGGGTCTCCGGGCGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073812397 Original CRISPR GGACGCGGCGCCCGGAGTCC CGG (reversed) Intergenic
No off target data available for this crispr