ID: 1073818763

View in Genome Browser
Species Human (GRCh38)
Location 10:107236328-107236350
Sequence AGATAGAGACAATACTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073818758_1073818763 30 Left 1073818758 10:107236275-107236297 CCCGTTTACAATGTCTGTTCTAA No data
Right 1073818763 10:107236328-107236350 AGATAGAGACAATACTGAGTAGG No data
1073818759_1073818763 29 Left 1073818759 10:107236276-107236298 CCGTTTACAATGTCTGTTCTAAC No data
Right 1073818763 10:107236328-107236350 AGATAGAGACAATACTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073818763 Original CRISPR AGATAGAGACAATACTGAGT AGG Intergenic
No off target data available for this crispr