ID: 1073818854

View in Genome Browser
Species Human (GRCh38)
Location 10:107237178-107237200
Sequence GGTGTCAAGAGACAAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073818854_1073818858 24 Left 1073818854 10:107237178-107237200 CCACATTTTTGTCTCTTGACACC No data
Right 1073818858 10:107237225-107237247 GCAACAGCCACAGCCTGAGAAGG No data
1073818854_1073818859 25 Left 1073818854 10:107237178-107237200 CCACATTTTTGTCTCTTGACACC No data
Right 1073818859 10:107237226-107237248 CAACAGCCACAGCCTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073818854 Original CRISPR GGTGTCAAGAGACAAAAATG TGG (reversed) Intergenic
No off target data available for this crispr