ID: 1073827212

View in Genome Browser
Species Human (GRCh38)
Location 10:107337478-107337500
Sequence AGGGAGATCACAGTGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073827212_1073827227 20 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827227 10:107337521-107337543 CTCTGGCTGCTGGGAGGTGGGGG No data
1073827212_1073827221 10 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827221 10:107337511-107337533 CACAGATTCTCTCTGGCTGCTGG No data
1073827212_1073827225 18 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827225 10:107337519-107337541 CTCTCTGGCTGCTGGGAGGTGGG No data
1073827212_1073827224 17 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827224 10:107337518-107337540 TCTCTCTGGCTGCTGGGAGGTGG No data
1073827212_1073827226 19 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827226 10:107337520-107337542 TCTCTGGCTGCTGGGAGGTGGGG No data
1073827212_1073827220 3 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827220 10:107337504-107337526 CCAAGTGCACAGATTCTCTCTGG No data
1073827212_1073827222 11 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827222 10:107337512-107337534 ACAGATTCTCTCTGGCTGCTGGG No data
1073827212_1073827223 14 Left 1073827212 10:107337478-107337500 CCCCCAGTCACTGTGATCTCCCT No data
Right 1073827223 10:107337515-107337537 GATTCTCTCTGGCTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073827212 Original CRISPR AGGGAGATCACAGTGACTGG GGG (reversed) Intergenic
No off target data available for this crispr