ID: 1073827711

View in Genome Browser
Species Human (GRCh38)
Location 10:107344464-107344486
Sequence ACTGATATCCAGAATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073827711_1073827712 -10 Left 1073827711 10:107344464-107344486 CCTTATACATTCTGGATATCAGT No data
Right 1073827712 10:107344477-107344499 GGATATCAGTCCTTTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073827711 Original CRISPR ACTGATATCCAGAATGTATA AGG (reversed) Intergenic
No off target data available for this crispr