ID: 1073830501 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:107377963-107377985 |
Sequence | GGCCTATTACTGGGCCTTAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073830501_1073830505 | 21 | Left | 1073830501 | 10:107377963-107377985 | CCACTAAGGCCCAGTAATAGGCC | No data | ||
Right | 1073830505 | 10:107378007-107378029 | GAGCAGTTATCTGTAGATGATGG | No data | ||||
1073830501_1073830506 | 25 | Left | 1073830501 | 10:107377963-107377985 | CCACTAAGGCCCAGTAATAGGCC | No data | ||
Right | 1073830506 | 10:107378011-107378033 | AGTTATCTGTAGATGATGGCAGG | No data | ||||
1073830501_1073830507 | 26 | Left | 1073830501 | 10:107377963-107377985 | CCACTAAGGCCCAGTAATAGGCC | No data | ||
Right | 1073830507 | 10:107378012-107378034 | GTTATCTGTAGATGATGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073830501 | Original CRISPR | GGCCTATTACTGGGCCTTAG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |