ID: 1073830502

View in Genome Browser
Species Human (GRCh38)
Location 10:107377972-107377994
Sequence ACAGTTCTTGGCCTATTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073830502_1073830506 16 Left 1073830502 10:107377972-107377994 CCCAGTAATAGGCCAAGAACTGT No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data
1073830502_1073830507 17 Left 1073830502 10:107377972-107377994 CCCAGTAATAGGCCAAGAACTGT No data
Right 1073830507 10:107378012-107378034 GTTATCTGTAGATGATGGCAGGG No data
1073830502_1073830505 12 Left 1073830502 10:107377972-107377994 CCCAGTAATAGGCCAAGAACTGT No data
Right 1073830505 10:107378007-107378029 GAGCAGTTATCTGTAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073830502 Original CRISPR ACAGTTCTTGGCCTATTACT GGG (reversed) Intergenic
No off target data available for this crispr