ID: 1073830504

View in Genome Browser
Species Human (GRCh38)
Location 10:107377984-107378006
Sequence TCTTTTTGAGAGACAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073830504_1073830508 27 Left 1073830504 10:107377984-107378006 CCAAGAACTGTCTCTCAAAAAGA No data
Right 1073830508 10:107378034-107378056 GCCTTGCTCTAATATCCTAAAGG No data
1073830504_1073830505 0 Left 1073830504 10:107377984-107378006 CCAAGAACTGTCTCTCAAAAAGA No data
Right 1073830505 10:107378007-107378029 GAGCAGTTATCTGTAGATGATGG No data
1073830504_1073830506 4 Left 1073830504 10:107377984-107378006 CCAAGAACTGTCTCTCAAAAAGA No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data
1073830504_1073830507 5 Left 1073830504 10:107377984-107378006 CCAAGAACTGTCTCTCAAAAAGA No data
Right 1073830507 10:107378012-107378034 GTTATCTGTAGATGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073830504 Original CRISPR TCTTTTTGAGAGACAGTTCT TGG (reversed) Intergenic
No off target data available for this crispr