ID: 1073830506

View in Genome Browser
Species Human (GRCh38)
Location 10:107378011-107378033
Sequence AGTTATCTGTAGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073830504_1073830506 4 Left 1073830504 10:107377984-107378006 CCAAGAACTGTCTCTCAAAAAGA No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data
1073830501_1073830506 25 Left 1073830501 10:107377963-107377985 CCACTAAGGCCCAGTAATAGGCC No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data
1073830502_1073830506 16 Left 1073830502 10:107377972-107377994 CCCAGTAATAGGCCAAGAACTGT No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data
1073830503_1073830506 15 Left 1073830503 10:107377973-107377995 CCAGTAATAGGCCAAGAACTGTC No data
Right 1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073830506 Original CRISPR AGTTATCTGTAGATGATGGC AGG Intergenic
No off target data available for this crispr