ID: 1073832574

View in Genome Browser
Species Human (GRCh38)
Location 10:107402807-107402829
Sequence CTCTATTTGTAAGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073832574_1073832578 -5 Left 1073832574 10:107402807-107402829 CCTTCTTCCCCTTACAAATAGAG No data
Right 1073832578 10:107402825-107402847 TAGAGCAGAAGCTCTATACTAGG No data
1073832574_1073832580 18 Left 1073832574 10:107402807-107402829 CCTTCTTCCCCTTACAAATAGAG No data
Right 1073832580 10:107402848-107402870 CACAGCAGGCTAATGAAAATAGG No data
1073832574_1073832579 4 Left 1073832574 10:107402807-107402829 CCTTCTTCCCCTTACAAATAGAG No data
Right 1073832579 10:107402834-107402856 AGCTCTATACTAGGCACAGCAGG No data
1073832574_1073832581 19 Left 1073832574 10:107402807-107402829 CCTTCTTCCCCTTACAAATAGAG No data
Right 1073832581 10:107402849-107402871 ACAGCAGGCTAATGAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073832574 Original CRISPR CTCTATTTGTAAGGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr