ID: 1073835337

View in Genome Browser
Species Human (GRCh38)
Location 10:107434983-107435005
Sequence AAGCTTTCTCCAACCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073835334_1073835337 17 Left 1073835334 10:107434943-107434965 CCAGGCTTCCTCTTCCTCTATCT No data
Right 1073835337 10:107434983-107435005 AAGCTTTCTCCAACCAACCATGG No data
1073835336_1073835337 3 Left 1073835336 10:107434957-107434979 CCTCTATCTTAAGACTCTTCATC No data
Right 1073835337 10:107434983-107435005 AAGCTTTCTCCAACCAACCATGG No data
1073835335_1073835337 9 Left 1073835335 10:107434951-107434973 CCTCTTCCTCTATCTTAAGACTC No data
Right 1073835337 10:107434983-107435005 AAGCTTTCTCCAACCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073835337 Original CRISPR AAGCTTTCTCCAACCAACCA TGG Intergenic
No off target data available for this crispr