ID: 1073836805

View in Genome Browser
Species Human (GRCh38)
Location 10:107453664-107453686
Sequence ATAAGGACCCTTGGTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073836805_1073836809 8 Left 1073836805 10:107453664-107453686 CCTGGAACACCAAGGGTCCTTAT No data
Right 1073836809 10:107453695-107453717 TTCCTTCCAGTACCAGCACATGG No data
1073836805_1073836813 27 Left 1073836805 10:107453664-107453686 CCTGGAACACCAAGGGTCCTTAT No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073836805 Original CRISPR ATAAGGACCCTTGGTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr