ID: 1073836809

View in Genome Browser
Species Human (GRCh38)
Location 10:107453695-107453717
Sequence TTCCTTCCAGTACCAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073836807_1073836809 -9 Left 1073836807 10:107453681-107453703 CCTTATGTTCCATATTCCTTCCA No data
Right 1073836809 10:107453695-107453717 TTCCTTCCAGTACCAGCACATGG No data
1073836806_1073836809 -1 Left 1073836806 10:107453673-107453695 CCAAGGGTCCTTATGTTCCATAT No data
Right 1073836809 10:107453695-107453717 TTCCTTCCAGTACCAGCACATGG No data
1073836805_1073836809 8 Left 1073836805 10:107453664-107453686 CCTGGAACACCAAGGGTCCTTAT No data
Right 1073836809 10:107453695-107453717 TTCCTTCCAGTACCAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073836809 Original CRISPR TTCCTTCCAGTACCAGCACA TGG Intergenic
No off target data available for this crispr