ID: 1073836813

View in Genome Browser
Species Human (GRCh38)
Location 10:107453714-107453736
Sequence ATGGCAGCCCAAAATAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073836810_1073836813 -6 Left 1073836810 10:107453697-107453719 CCTTCCAGTACCAGCACATGGCA No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data
1073836811_1073836813 -10 Left 1073836811 10:107453701-107453723 CCAGTACCAGCACATGGCAGCCC No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data
1073836806_1073836813 18 Left 1073836806 10:107453673-107453695 CCAAGGGTCCTTATGTTCCATAT No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data
1073836807_1073836813 10 Left 1073836807 10:107453681-107453703 CCTTATGTTCCATATTCCTTCCA No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data
1073836808_1073836813 1 Left 1073836808 10:107453690-107453712 CCATATTCCTTCCAGTACCAGCA No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data
1073836805_1073836813 27 Left 1073836805 10:107453664-107453686 CCTGGAACACCAAGGGTCCTTAT No data
Right 1073836813 10:107453714-107453736 ATGGCAGCCCAAAATAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073836813 Original CRISPR ATGGCAGCCCAAAATAAAAA TGG Intergenic
No off target data available for this crispr