ID: 1073839485

View in Genome Browser
Species Human (GRCh38)
Location 10:107482152-107482174
Sequence CTGTCTTTGCAGATGAACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073839485_1073839491 18 Left 1073839485 10:107482152-107482174 CCTCCGTTCATCTGCAAAGACAG No data
Right 1073839491 10:107482193-107482215 CTCTCTCTTTCTCTGGGTGCGGG No data
1073839485_1073839489 12 Left 1073839485 10:107482152-107482174 CCTCCGTTCATCTGCAAAGACAG No data
Right 1073839489 10:107482187-107482209 CTCTCTCTCTCTCTTTCTCTGGG 0: 15
1: 177
2: 407
3: 1059
4: 3027
1073839485_1073839490 17 Left 1073839485 10:107482152-107482174 CCTCCGTTCATCTGCAAAGACAG No data
Right 1073839490 10:107482192-107482214 TCTCTCTCTTTCTCTGGGTGCGG No data
1073839485_1073839488 11 Left 1073839485 10:107482152-107482174 CCTCCGTTCATCTGCAAAGACAG No data
Right 1073839488 10:107482186-107482208 TCTCTCTCTCTCTCTTTCTCTGG 0: 14
1: 273
2: 560
3: 1575
4: 4532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073839485 Original CRISPR CTGTCTTTGCAGATGAACGG AGG (reversed) Intergenic
No off target data available for this crispr