ID: 1073841679

View in Genome Browser
Species Human (GRCh38)
Location 10:107505100-107505122
Sequence CATGTTGGTCAACCTAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073841679_1073841681 -6 Left 1073841679 10:107505100-107505122 CCATGATTAGGTTGACCAACATG No data
Right 1073841681 10:107505117-107505139 AACATGTTCTATGACTATCCAGG No data
1073841679_1073841682 8 Left 1073841679 10:107505100-107505122 CCATGATTAGGTTGACCAACATG No data
Right 1073841682 10:107505131-107505153 CTATCCAGGTTTTCAACTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073841679 Original CRISPR CATGTTGGTCAACCTAATCA TGG (reversed) Intergenic
No off target data available for this crispr