ID: 1073842824

View in Genome Browser
Species Human (GRCh38)
Location 10:107517597-107517619
Sequence AAAGAATTCCACATCTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073842815_1073842824 26 Left 1073842815 10:107517548-107517570 CCGGGATCAGTACTACACATGGT No data
Right 1073842824 10:107517597-107517619 AAAGAATTCCACATCTATAAAGG No data
1073842823_1073842824 -6 Left 1073842823 10:107517580-107517602 CCACTGGGGGGTCTTGGAAAGAA No data
Right 1073842824 10:107517597-107517619 AAAGAATTCCACATCTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073842824 Original CRISPR AAAGAATTCCACATCTATAA AGG Intergenic
No off target data available for this crispr