ID: 1073846625

View in Genome Browser
Species Human (GRCh38)
Location 10:107563336-107563358
Sequence ATATATAAAAGGCTGTGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073846621_1073846625 18 Left 1073846621 10:107563295-107563317 CCCTATACTATTCCGTACATAGA No data
Right 1073846625 10:107563336-107563358 ATATATAAAAGGCTGTGCTATGG No data
1073846622_1073846625 17 Left 1073846622 10:107563296-107563318 CCTATACTATTCCGTACATAGAG No data
Right 1073846625 10:107563336-107563358 ATATATAAAAGGCTGTGCTATGG No data
1073846623_1073846625 6 Left 1073846623 10:107563307-107563329 CCGTACATAGAGAGTCTCATTGT No data
Right 1073846625 10:107563336-107563358 ATATATAAAAGGCTGTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073846625 Original CRISPR ATATATAAAAGGCTGTGCTA TGG Intergenic
No off target data available for this crispr