ID: 1073851943

View in Genome Browser
Species Human (GRCh38)
Location 10:107631811-107631833
Sequence CCCAGTAGGGCCCATGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073851943_1073851947 1 Left 1073851943 10:107631811-107631833 CCTGCTACATGGGCCCTACTGGG No data
Right 1073851947 10:107631835-107631857 TCTCAATAAATACATTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073851943 Original CRISPR CCCAGTAGGGCCCATGTAGC AGG (reversed) Intergenic
No off target data available for this crispr