ID: 1073857655

View in Genome Browser
Species Human (GRCh38)
Location 10:107696142-107696164
Sequence CCTTATTTACAGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073857652_1073857655 -5 Left 1073857652 10:107696124-107696146 CCATATTGTGGCTCTGCTCCTTA No data
Right 1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073857655 Original CRISPR CCTTATTTACAGAGAGAAGA GGG Intergenic
No off target data available for this crispr