ID: 1073858013

View in Genome Browser
Species Human (GRCh38)
Location 10:107699795-107699817
Sequence CCCCTCTTCTAATTAGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073858013_1073858020 7 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858020 10:107699825-107699847 ATTAATGCAGTCTGGGCTGTGGG No data
1073858013_1073858023 16 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858023 10:107699834-107699856 GTCTGGGCTGTGGGTGAGGTGGG No data
1073858013_1073858021 12 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858021 10:107699830-107699852 TGCAGTCTGGGCTGTGGGTGAGG No data
1073858013_1073858019 6 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858019 10:107699824-107699846 AATTAATGCAGTCTGGGCTGTGG No data
1073858013_1073858026 24 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858026 10:107699842-107699864 TGTGGGTGAGGTGGGAGGATGGG No data
1073858013_1073858018 0 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858018 10:107699818-107699840 ATTGTTAATTAATGCAGTCTGGG No data
1073858013_1073858022 15 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858022 10:107699833-107699855 AGTCTGGGCTGTGGGTGAGGTGG No data
1073858013_1073858024 19 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858024 10:107699837-107699859 TGGGCTGTGGGTGAGGTGGGAGG No data
1073858013_1073858017 -1 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858017 10:107699817-107699839 GATTGTTAATTAATGCAGTCTGG No data
1073858013_1073858025 23 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG No data
1073858013_1073858027 25 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858027 10:107699843-107699865 GTGGGTGAGGTGGGAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073858013 Original CRISPR CCCCTCTTCTAATTAGCTTG GGG (reversed) Intergenic
No off target data available for this crispr