ID: 1073858025

View in Genome Browser
Species Human (GRCh38)
Location 10:107699841-107699863
Sequence CTGTGGGTGAGGTGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073858016_1073858025 21 Left 1073858016 10:107699797-107699819 CCAAGCTAATTAGAAGAGGGGAT No data
Right 1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG No data
1073858015_1073858025 22 Left 1073858015 10:107699796-107699818 CCCAAGCTAATTAGAAGAGGGGA No data
Right 1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG No data
1073858013_1073858025 23 Left 1073858013 10:107699795-107699817 CCCCAAGCTAATTAGAAGAGGGG No data
Right 1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073858025 Original CRISPR CTGTGGGTGAGGTGGGAGGA TGG Intergenic
No off target data available for this crispr