ID: 1073858126

View in Genome Browser
Species Human (GRCh38)
Location 10:107701435-107701457
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073858123_1073858126 19 Left 1073858123 10:107701393-107701415 CCAGGTCACTAGAAGGAAGTGTG No data
Right 1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073858126 Original CRISPR CCAGATCACCAGGTCTCTCT TGG Intergenic
No off target data available for this crispr