ID: 1073860472

View in Genome Browser
Species Human (GRCh38)
Location 10:107732553-107732575
Sequence TAAAATCTCCTAGAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073860468_1073860472 2 Left 1073860468 10:107732528-107732550 CCAGTTCTGACAGTTACCATAAG No data
Right 1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG No data
1073860466_1073860472 13 Left 1073860466 10:107732517-107732539 CCCTGCTCTGTCCAGTTCTGACA No data
Right 1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG No data
1073860467_1073860472 12 Left 1073860467 10:107732518-107732540 CCTGCTCTGTCCAGTTCTGACAG No data
Right 1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG No data
1073860465_1073860472 16 Left 1073860465 10:107732514-107732536 CCACCCTGCTCTGTCCAGTTCTG No data
Right 1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073860472 Original CRISPR TAAAATCTCCTAGAGGAGCA TGG Intergenic
No off target data available for this crispr