ID: 1073869769

View in Genome Browser
Species Human (GRCh38)
Location 10:107849890-107849912
Sequence TGGATCAGTAGAGGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073869769_1073869777 23 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869777 10:107849936-107849958 TCTCATAAAATTAGTTAGGGAGG No data
1073869769_1073869773 -3 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869773 10:107849910-107849932 CCATCAGATCTCAACTTAAAAGG No data
1073869769_1073869774 19 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869774 10:107849932-107849954 GCCTTCTCATAAAATTAGTTAGG No data
1073869769_1073869776 20 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869776 10:107849933-107849955 CCTTCTCATAAAATTAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073869769 Original CRISPR TGGATCAGTAGAGGTTGGCC AGG (reversed) Intergenic