ID: 1073869770 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:107849895-107849917 |
Sequence | TCTGATGGATCAGTAGAGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073869770_1073869776 | 15 | Left | 1073869770 | 10:107849895-107849917 | CCAACCTCTACTGATCCATCAGA | No data | ||
Right | 1073869776 | 10:107849933-107849955 | CCTTCTCATAAAATTAGTTAGGG | No data | ||||
1073869770_1073869777 | 18 | Left | 1073869770 | 10:107849895-107849917 | CCAACCTCTACTGATCCATCAGA | No data | ||
Right | 1073869777 | 10:107849936-107849958 | TCTCATAAAATTAGTTAGGGAGG | No data | ||||
1073869770_1073869774 | 14 | Left | 1073869770 | 10:107849895-107849917 | CCAACCTCTACTGATCCATCAGA | No data | ||
Right | 1073869774 | 10:107849932-107849954 | GCCTTCTCATAAAATTAGTTAGG | No data | ||||
1073869770_1073869773 | -8 | Left | 1073869770 | 10:107849895-107849917 | CCAACCTCTACTGATCCATCAGA | No data | ||
Right | 1073869773 | 10:107849910-107849932 | CCATCAGATCTCAACTTAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073869770 | Original CRISPR | TCTGATGGATCAGTAGAGGT TGG (reversed) | Intergenic | ||