ID: 1073869773

View in Genome Browser
Species Human (GRCh38)
Location 10:107849910-107849932
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073869767_1073869773 23 Left 1073869767 10:107849864-107849886 CCTCAGTGCTACACTGATTTGAG No data
Right 1073869773 10:107849910-107849932 CCATCAGATCTCAACTTAAAAGG No data
1073869770_1073869773 -8 Left 1073869770 10:107849895-107849917 CCAACCTCTACTGATCCATCAGA No data
Right 1073869773 10:107849910-107849932 CCATCAGATCTCAACTTAAAAGG No data
1073869769_1073869773 -3 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869773 10:107849910-107849932 CCATCAGATCTCAACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073869773 Original CRISPR CCATCAGATCTCAACTTAAA AGG Intergenic