ID: 1073869776

View in Genome Browser
Species Human (GRCh38)
Location 10:107849933-107849955
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073869769_1073869776 20 Left 1073869769 10:107849890-107849912 CCTGGCCAACCTCTACTGATCCA No data
Right 1073869776 10:107849933-107849955 CCTTCTCATAAAATTAGTTAGGG No data
1073869771_1073869776 11 Left 1073869771 10:107849899-107849921 CCTCTACTGATCCATCAGATCTC No data
Right 1073869776 10:107849933-107849955 CCTTCTCATAAAATTAGTTAGGG No data
1073869772_1073869776 0 Left 1073869772 10:107849910-107849932 CCATCAGATCTCAACTTAAAAGG No data
Right 1073869776 10:107849933-107849955 CCTTCTCATAAAATTAGTTAGGG No data
1073869770_1073869776 15 Left 1073869770 10:107849895-107849917 CCAACCTCTACTGATCCATCAGA No data
Right 1073869776 10:107849933-107849955 CCTTCTCATAAAATTAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073869776 Original CRISPR CCTTCTCATAAAATTAGTTA GGG Intergenic