ID: 1073875282

View in Genome Browser
Species Human (GRCh38)
Location 10:107914993-107915015
Sequence AAGTCGGGCCGCGGCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073875275_1073875282 -9 Left 1073875275 10:107914979-107915001 CCCTAACTTTAGCGAAGTCGGGC No data
Right 1073875282 10:107914993-107915015 AAGTCGGGCCGCGGCGGGGCGGG No data
1073875276_1073875282 -10 Left 1073875276 10:107914980-107915002 CCTAACTTTAGCGAAGTCGGGCC No data
Right 1073875282 10:107914993-107915015 AAGTCGGGCCGCGGCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073875282 Original CRISPR AAGTCGGGCCGCGGCGGGGC GGG Intergenic