ID: 1073876885

View in Genome Browser
Species Human (GRCh38)
Location 10:107934608-107934630
Sequence CTATTTTAACAACATTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073876883_1073876885 -1 Left 1073876883 10:107934586-107934608 CCTGCTACTTTTCTTCCTTTATC No data
Right 1073876885 10:107934608-107934630 CTATTTTAACAACATTCCATTGG No data
1073876882_1073876885 8 Left 1073876882 10:107934577-107934599 CCATGCAGTCCTGCTACTTTTCT No data
Right 1073876885 10:107934608-107934630 CTATTTTAACAACATTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073876885 Original CRISPR CTATTTTAACAACATTCCAT TGG Intergenic
No off target data available for this crispr