ID: 1073881067

View in Genome Browser
Species Human (GRCh38)
Location 10:107980646-107980668
Sequence ATTGATGGTTCAGGTCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073881067_1073881071 14 Left 1073881067 10:107980646-107980668 CCATTTGGACCTGAACCATCAAT No data
Right 1073881071 10:107980683-107980705 TCCCCCTACCTCCTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073881067 Original CRISPR ATTGATGGTTCAGGTCCAAA TGG (reversed) Intergenic
No off target data available for this crispr