ID: 1073881068

View in Genome Browser
Species Human (GRCh38)
Location 10:107980655-107980677
Sequence ATTGATTTCATTGATGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073881068_1073881071 5 Left 1073881068 10:107980655-107980677 CCTGAACCATCAATGAAATCAAT No data
Right 1073881071 10:107980683-107980705 TCCCCCTACCTCCTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073881068 Original CRISPR ATTGATTTCATTGATGGTTC AGG (reversed) Intergenic
No off target data available for this crispr