ID: 1073885660

View in Genome Browser
Species Human (GRCh38)
Location 10:108036880-108036902
Sequence CCTTATATGAATAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073885660_1073885665 18 Left 1073885660 10:108036880-108036902 CCCTCTGCCTTATTCATATAAGG No data
Right 1073885665 10:108036921-108036943 AGAACCCCCCTGGATATTTCAGG No data
1073885660_1073885664 8 Left 1073885660 10:108036880-108036902 CCCTCTGCCTTATTCATATAAGG No data
Right 1073885664 10:108036911-108036933 AATTCAACTTAGAACCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073885660 Original CRISPR CCTTATATGAATAAGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr