ID: 1073890069

View in Genome Browser
Species Human (GRCh38)
Location 10:108091025-108091047
Sequence CAGTACTCACAGTGGGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073890062_1073890069 5 Left 1073890062 10:108090997-108091019 CCTTGAGTGAACATCAGAGGTAA No data
Right 1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG No data
1073890060_1073890069 12 Left 1073890060 10:108090990-108091012 CCTTAGGCCTTGAGTGAACATCA No data
Right 1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073890069 Original CRISPR CAGTACTCACAGTGGGCACG GGG Intergenic
No off target data available for this crispr