ID: 1073893937

View in Genome Browser
Species Human (GRCh38)
Location 10:108132295-108132317
Sequence ACATGGACACACATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073893935_1073893937 -8 Left 1073893935 10:108132280-108132302 CCAAGGAAATCAAGGACATGGAC 0: 20
1: 35
2: 79
3: 126
4: 370
Right 1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG No data
1073893931_1073893937 13 Left 1073893931 10:108132259-108132281 CCTGAGGTTTGTCATCTTACGCC No data
Right 1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073893937 Original CRISPR ACATGGACACACATGGAGTG AGG Intergenic
No off target data available for this crispr