ID: 1073894118

View in Genome Browser
Species Human (GRCh38)
Location 10:108134409-108134431
Sequence AAGGGATAATTCCACTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073894118_1073894123 18 Left 1073894118 10:108134409-108134431 CCTATCCAGTGGAATTATCCCTT No data
Right 1073894123 10:108134450-108134472 AAGACTTAGACAGCACCTGAGGG No data
1073894118_1073894122 17 Left 1073894118 10:108134409-108134431 CCTATCCAGTGGAATTATCCCTT No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073894118 Original CRISPR AAGGGATAATTCCACTGGAT AGG (reversed) Intergenic
No off target data available for this crispr