ID: 1073894122

View in Genome Browser
Species Human (GRCh38)
Location 10:108134449-108134471
Sequence AAAGACTTAGACAGCACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073894119_1073894122 12 Left 1073894119 10:108134414-108134436 CCAGTGGAATTATCCCTTAAAAG No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data
1073894118_1073894122 17 Left 1073894118 10:108134409-108134431 CCTATCCAGTGGAATTATCCCTT No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data
1073894117_1073894122 18 Left 1073894117 10:108134408-108134430 CCCTATCCAGTGGAATTATCCCT No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data
1073894121_1073894122 -2 Left 1073894121 10:108134428-108134450 CCTTAAAAGTGCACAAGAAATAA No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data
1073894120_1073894122 -1 Left 1073894120 10:108134427-108134449 CCCTTAAAAGTGCACAAGAAATA No data
Right 1073894122 10:108134449-108134471 AAAGACTTAGACAGCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073894122 Original CRISPR AAAGACTTAGACAGCACCTG AGG Intergenic
No off target data available for this crispr