ID: 1073899538

View in Genome Browser
Species Human (GRCh38)
Location 10:108204035-108204057
Sequence CAGAACTATCTGGAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073899530_1073899538 11 Left 1073899530 10:108204001-108204023 CCTGCTCTGTCCATGTCCACCAG No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data
1073899528_1073899538 26 Left 1073899528 10:108203986-108204008 CCTGCAAGAAACAGCCCTGCTCT No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data
1073899533_1073899538 -5 Left 1073899533 10:108204017-108204039 CCACCAGTGAACAAAGGCCAGAA No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data
1073899529_1073899538 12 Left 1073899529 10:108204000-108204022 CCCTGCTCTGTCCATGTCCACCA No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data
1073899534_1073899538 -8 Left 1073899534 10:108204020-108204042 CCAGTGAACAAAGGCCAGAACTA No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data
1073899531_1073899538 1 Left 1073899531 10:108204011-108204033 CCATGTCCACCAGTGAACAAAGG No data
Right 1073899538 10:108204035-108204057 CAGAACTATCTGGAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073899538 Original CRISPR CAGAACTATCTGGAGGAGTA TGG Intergenic
No off target data available for this crispr