ID: 1073899887

View in Genome Browser
Species Human (GRCh38)
Location 10:108207757-108207779
Sequence TATGCATGAGTCACCGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073899887_1073899888 -6 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899888 10:108207774-108207796 TGCATATAATCCCAGCACTTTGG 0: 45
1: 11751
2: 119365
3: 250347
4: 243182
1073899887_1073899896 11 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899896 10:108207791-108207813 CTTTGGGAGGCTGAGGCGGGCGG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
1073899887_1073899889 -5 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899889 10:108207775-108207797 GCATATAATCCCAGCACTTTGGG 0: 103
1: 22674
2: 257458
3: 275668
4: 172255
1073899887_1073899895 8 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899895 10:108207788-108207810 GCACTTTGGGAGGCTGAGGCGGG 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
1073899887_1073899890 -2 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899890 10:108207778-108207800 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
1073899887_1073899897 20 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899897 10:108207800-108207822 GCTGAGGCGGGCGGATCACAAGG 0: 1022
1: 9061
2: 36735
3: 60592
4: 66639
1073899887_1073899894 7 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899894 10:108207787-108207809 AGCACTTTGGGAGGCTGAGGCGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1073899887_1073899892 4 Left 1073899887 10:108207757-108207779 CCAGGTGCGGTGACTCATGCATA No data
Right 1073899892 10:108207784-108207806 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073899887 Original CRISPR TATGCATGAGTCACCGCACC TGG (reversed) Intergenic
No off target data available for this crispr