ID: 1073902399

View in Genome Browser
Species Human (GRCh38)
Location 10:108238337-108238359
Sequence ACATCAAGGGTAGCAGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073902399_1073902403 8 Left 1073902399 10:108238337-108238359 CCCATTGCTGCTACCCTTGATGT No data
Right 1073902403 10:108238368-108238390 CACAGCAGAATTTTTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073902399 Original CRISPR ACATCAAGGGTAGCAGCAAT GGG (reversed) Intergenic
No off target data available for this crispr