ID: 1073904440 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:108261603-108261625 |
| Sequence | TATCATCTATAGCAGGTGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073904440_1073904445 | 2 | Left | 1073904440 | 10:108261603-108261625 | CCAAGCACCTGCTATAGATGATA | No data | ||
| Right | 1073904445 | 10:108261628-108261650 | ACCCTAAGGGCTTGAGAGGAAGG | No data | ||||
| 1073904440_1073904444 | -2 | Left | 1073904440 | 10:108261603-108261625 | CCAAGCACCTGCTATAGATGATA | No data | ||
| Right | 1073904444 | 10:108261624-108261646 | TACGACCCTAAGGGCTTGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073904440 | Original CRISPR | TATCATCTATAGCAGGTGCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||