ID: 1073904440

View in Genome Browser
Species Human (GRCh38)
Location 10:108261603-108261625
Sequence TATCATCTATAGCAGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073904440_1073904445 2 Left 1073904440 10:108261603-108261625 CCAAGCACCTGCTATAGATGATA No data
Right 1073904445 10:108261628-108261650 ACCCTAAGGGCTTGAGAGGAAGG No data
1073904440_1073904444 -2 Left 1073904440 10:108261603-108261625 CCAAGCACCTGCTATAGATGATA No data
Right 1073904444 10:108261624-108261646 TACGACCCTAAGGGCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073904440 Original CRISPR TATCATCTATAGCAGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr