ID: 1073906438

View in Genome Browser
Species Human (GRCh38)
Location 10:108285943-108285965
Sequence CCACATGCATAGATTCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073906438_1073906441 20 Left 1073906438 10:108285943-108285965 CCCTGTAGAATCTATGCATGTGG No data
Right 1073906441 10:108285986-108286008 GTGTATTTTAAATCTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073906438 Original CRISPR CCACATGCATAGATTCTACA GGG (reversed) Intergenic
No off target data available for this crispr