ID: 1073906441

View in Genome Browser
Species Human (GRCh38)
Location 10:108285986-108286008
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073906438_1073906441 20 Left 1073906438 10:108285943-108285965 CCCTGTAGAATCTATGCATGTGG No data
Right 1073906441 10:108285986-108286008 GTGTATTTTAAATCTGCATTTGG No data
1073906440_1073906441 19 Left 1073906440 10:108285944-108285966 CCTGTAGAATCTATGCATGTGGA No data
Right 1073906441 10:108285986-108286008 GTGTATTTTAAATCTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073906441 Original CRISPR GTGTATTTTAAATCTGCATT TGG Intergenic
No off target data available for this crispr